Information

Isolation of Intact Granules from Mast Cells

Isolation of Intact Granules from Mast Cells


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

How to isolate intact granules from mast cells without using sucrose and percoll?


Polyamines Are Present in Mast Cell Secretory Granules and Are Important for Granule Homeostasis

Mast cell secretory granules accommodate a large number of components, many of which interact with highly sulfated serglycin proteoglycan (PG) present within the granules. Polyamines (putrescine, spermidine and spermine) are absolutely required for the survival of the vast majority of living cells. Given the reported ability of polyamines to interact with PGs, we investigated the possibility that polyamines may be components of mast cell secretory granules.

Methodology/Principal Findings

Spermidine was released by mouse bone marrow derived mast cells (BMMCs) after degranulation induced by IgE/anti-IgE or calcium ionophore A23187. Additionally, both spermidine and spermine were detected in isolated mouse mast cell granules. Further, depletion of polyamines by culturing BMMCs with α-difluoromethylornithine (DFMO) caused aberrant secretory granule ultrastructure, impaired histamine storage, reduced serotonin levels and increased β-hexosaminidase content. A proteomic approach revealed that DFMO-induced polyamine depletion caused an alteration in the levels of a number of proteins, many of which are connected either with the regulated exocytosis or with the endocytic system.

Conclusions/Significance

Taken together, our results show evidence that polyamines are present in mast cell secretory granules and, furthermore, indicate an essential role of these polycations during the biogenesis and homeostasis of these organelles.

Citation: García-Faroldi G, Rodríguez CE, Urdiales JL, Pérez-Pomares JM, Dávila JC, Pejler G, et al. (2010) Polyamines Are Present in Mast Cell Secretory Granules and Are Important for Granule Homeostasis. PLoS ONE 5(11): e15071. https://doi.org/10.1371/journal.pone.0015071

Editor: David Holowka, Cornell University, United States of America

Received: September 6, 2010 Accepted: October 19, 2010 Published: November 30, 2010

Copyright: © 2010 García-Faroldi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants SAF2008-02522 (Ministerio de Ciencia e Innovación, Spain), P07-CVI-02999 and BIO-267 group (Junta de Andalucía, Spain) and funds provided by Fundación Ramón Areces (Spain). It was also helped by the European Cooperation in Science and Technology (COST) Action BM0806, supported by the European Union (EU) Framework Programme for Research and Technological Development (RTD). The CIBER-ER is an initiative of the Instituto de Salud Carlos III (Spain). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.


Introduction

Mast cells are important cells of the immune system and are of the hematopoietic lineage. Mast cells are originated from pluripotent progenitor cells of the bone marrow, and mature under the influence of the c-kit ligand and stem cell factor in the presence of other distinct growth factors provided by the microenvironment of the tissue where they are destined to reside. Under normal conditions, mature mast cells do not circulate in the bloodstream. However, mast cell progenitors migrate into tissues and differentiate into mast cells under the influence of stem cell factor and various cytokines. Mast cells are present throughout the body and they play important roles in the maintenance of many physiological functions as well as in the pathophysiology of diseases. Accordingly, this review is focused on the role of mast cells in a wide range of physiological functions and pathogenesis of a variety of disease states.

Location of Mast Cells

Mast cells are found in mucosal and epithelial tissues throughout the body. In rodents, mast cells also reside in peritoneal and thoracic cavities. Mast cells are found in all vascularized tissues except for the central nervous system and the retina (1). Mast cells are located at the junction point of the host and external environment at places of entry of antigen (gastrointestinal tract, skin, respiratory epithelium) (1𠄴). Mast cells are located in areas below the epithelium in connective tissue surrounding blood cells, smooth muscle, mucous, and hair follicles.

The cytoplasm of the mast cell contains 50� large granules that store inflammatory mediators, including histamine, heparin, a variety of cytokines, chondroitin sulfate, and neutral proteases (1). In order for mast cells to migrate to their target locations, the co-ordinated effects of integrins, adhesion molecules, chemokines, cytokines, and growth factors are necessary (5). Mast cell progenitors are found in high numbers in the small intestine. CXCR2 expressed on mast cell progenitors directs their migration to the small intestine. Binding of 㬔㬧 integrins (expressed on mast cells) to adhesion molecule VCAM-1 on the endothelium initiates the transit of mast cell precursors out of the circulation (5).

The lungs do not have many mast cell progenitors in a normal physiological state. Upon antigen-induced inflammation of the respiratory endothelium, mast cell progenitors are recruited by engaging 㬔㬧 integrins, VCAM-1, and CXCR2. Additionally, CCR-2 and CCL-2 are involved in the recruitment of mast cell progenitors to the respiratory endothelium. When mature mast cells are activated and degranulated, more mast cell progenitors are recruited to the site of inflammation (5).

There are two phenotypes of human mast cells: mucosal mast cells that produce only tryptase and connective tissue mast cells that produce chymase, tryptase, and carboxypeptidases (6, 7). Mast cell activation and mediator release have different effects in various tissues and organs. Most common sites in the body exposed to antigens are the mucosa of the respiratory tract (airborne), gastrointestinal tract (food borne), blood (wounds, absorption from respiratory tract/gastrointestinal tract), and connective tissues (8).

When the gastrointestinal tract is exposed to an antigen, its response is to increase fluid secretion, increase smooth muscle contraction, and increase peristalsis. Proteins derived from different plants and animals can act as antigens and activate the immune system in vulnerable subjects (8). The antigen (peptide) permeates through the epithelial layer of the mucosa of the gut and binds to IgE on mucosal mast cells. These peptides are presented to Th2 cells, and if there is an IgE antibody against the peptide present, it will cause activation of the mast cell resulting in an immune response. This causes mast cells to degranulate and release a variety of inflammatory mediators. These mediators increase vascular permeability, causing edema in the gut epithelium and smooth muscle contraction, which lead to vomiting and diarrhea. This type of reaction can occur in response to peptides found in certain medications. Food allergens can also cause skin reactions. Uptake from the gastrointestinal tract can introduce antigens into the blood, which are transported throughout the body where they bind to IgE on mast cells in the connective tissue in the deep layers of the skin. This results in urticarial reaction and angioedema (8).

In the respiratory tract, the immune response to mast cell activation results in airway constriction, increased mucous production, and cough (1). The most common introduction of antigens to the respiratory tract is via inhalation. Mucosal mast cells in the nasal epithelium are activated by antigens that diffuse across the mucosa after being inhaled. In the respiratory tract, mast cell degranulation increases vascular permeability and local edema, which can obstruct nasal airways and lead to congestion (9, 10). There is increased production of mucus and its accumulation can block off the sinuses and result in a bacterial infection. Mast cells also play a pivotal role in the pathophysiology of allergic asthma. This is caused by an inflammatory response in the airways, which results from inhaled antigens that get into the lower respiratory tract and cause mast cell degranulation and local inflammation. These events lead to increased vascular permeability, fluid accumulation, and edema, which can obstruct the airways. Bronchial constriction can occur due to smooth muscle contraction, which can lead to airway obstruction that is seen in asthma. Air is, therefore, trapped and total lung capacity is increased while forced expiratory volume in 1 s (FEV1) and forced vital capacity (FVC) are decreased (8). In the blood vessels, increased vascular permeability leads to edema and local inflammation, which results in antigen transport to the lymph nodes (11).

In the skin, antigens, via IgE, activate mast cells in the deep layers of connective tissue. Mast cells release histamine as well as other vasoactive molecules, which cause urticaria (hives). If the antigen activates mast cells in deeper tissue, this can lead to angioedema. If the response is prolonged, atopic dermatitis or eczema may occur. Eczema is seen clinically as a chronic itching skin rash with raised lesions and fluid discharge. Eczema is more commonly seen in childhood while allergic rhinitis and asthma are seen throughout life (8).

Mechanism of Activation

Mast cells are known for their main mechanism of action: IgE-mediated allergic reactions through the FcϵRI receptor. IgE antibodies are produced by mature B cells in response to CD4+ Th2 cells. Naïve mature B cells produce IgM and IgD antibodies. Once they become activated by an antigen, B cells will proliferate. If these B cells interact with cytokines, such as IL-4 (which is modulated by CD4+ Th2 cells), the antibody class switches from IgM to IgE (12). IgE is mostly found bound to FcϵRI receptors on the mast cell, and very little IgE is found as a soluble antibody in circulation. When an antigen comes in contact with the mast cell, it crosslinks two or more FcϵRI molecules and activates the release of granules from the mast cell (13). IgE is found in the connective tissue under epithelial layers of the skin, in the respiratory tract, and also in the gastrointestinal tract (1). In addition to FcϵRI, mast cells also express Fc receptors for IgA and IgG, receptors for adenosine, C3a, chemokines, cytokines, and pathogen-associated molecular patterns (PAMPs), as well as toll-like receptors (TLRs), all of which are involved in mast cell activation and immune response.

The most common physiological pathway for mast cell activation is via antigen/IgE/FcϵRI cross linking (14). FcϵRI consists of an α-chain that binds to IgE, a β-chain, which spans the membrane, and γ chains, which are a disulfide-linked homodimer. FcϵRI interacts with LYN tyrosine kinase, which phosphorylates the tyrosine in its immunoreceptor tyrosine bases activation motifs (ITAMs) on the B and γ chains of the FcϵRI (15). Lyn activates Syk tyrosine kinases, which phosphorylates signaling proteins, such as LAT1 and LAT2 (linkers for activation of T cells) (16). Phosphorylated PLCγ hydrolyzes phosphatidylinositol-4,5-bisphosphate to make inositol-1,4,5-triphosphate (IP3) and diacylglycerol (DAG). IP3 and DAG are second messengers and IP3 causes calcium mobilization from the endoplasmic reticulum (17). Calcium release activates and causes NF㮫 to translocate to the nucleus of the cell, which results in transcription of cytokines, such as IL-6, TNFα, and IL-13. Zeb2 is involved in regulation of degranulation upon stimulation via FcϵRI (18). Activation of FcϵRI activates Fyn (Src kinase). Fyn regulates mast cell degranulation, which is complementary to the Lyn signaling pathway. Fyn activates PI3K, which activates Akt and produces PIP3 (15). This activates mTOR, which is involved in mast cell chemotaxis and cytokine production (14). There are also receptors for IgG called FcγR. The y-chain homodimer is the same in FcγRI as in FcϵRI so the signal sent from FcγR can crosstalk with FcϵRI (14). Repeated and controlled exposure of mast cells to antigen can desensitize a patient’s sensitivity. Although the mechanisms are not clearly understood, the slow and persistent degranulation of mast cells is thought to be one of the mechanisms. The desensitization protocol is used in patients who are allergic to certain drugs (e.g., penicillin) but need treatment for a life-threatening bacterial infection that can only be treated with this drug.

Mast cell desensitization can occur from exposure to increasing doses of antigen. This technique can be used if a patient is allergic to a necessary drug and prevention of anaphylactic reactions to food. By desensitizing the receptors, this can decrease the number of FcϵRI molecules available on the mast cell surface (19).


Isolation and characterization of plasma membrane-associated cortical granules from sea urchin eggs

Cortical granules, which are specialized secretory organelles found in ova of many organisms, have been isolated from the eggs of the sea urchins Arbacia punctulata and Strongylocentrtus pupuratus by a simple, rapid procedure. Electron micropscope examination of cortical granules prepared by this procedure reveals that they are tightly attached to large segments of the plasma membrane and its associated vitelline layer. Further evidence that he cortical granules were associated with these cell surface layers was obtained by (125)I-labeling techniques. The cortical granule preparations were found to be rich in proteoesterase, which was purified 32-fold over that detected in a crude homogenate. Similarly, the specific radioactivity of a (125)I-labeled, surface glycoprotein was increased 40-fold. These facts, coupled with electron microscope observations, indicate the isolation procedure yields a preparation in which both the cortical granules and the plasma membrane-vitelline layer are purified to the same extent. Gel electrophoresis of the membrane-associated cortical granule preparation reveals the presence of at least eight polypeptides. The major polypeptide, which is a glycotprotein of apparent mol wt of 100,000, contains most of the radioactivity introduced by (125)I-labeling of the intact eggs. Lysis of the cortical granules is observed under hypotonic conditions, or under isotonic conditions if Ca(2+) ion is present. When lysis is under isotonic conditions is induced by addition of Ca(2+) ion, the electron-dense contents of the granules remain insoluble. In contrast, hypotonic lysis results in release of the contents of the granule in a soluble form. However, in both cases the (125)I-labeled glycoprotein remains insoluble, presumably because it is a component of either the plasma membrane or the vitelline layer. All these findings indicate that, using this purified preparation, it should be possible to carry out in vitro studies to better define some of the initial, surface-related events observed in vivo upon fertilization.


Abstract

Objective— Recent studies have highlighted the pathogenetic importance of chronic inflammation in cardiovascular disorders such as congestive heart failure and atherosclerosis. Mast cells release a wide variety of immune mediators that may initiate inflammatory responses, whereas endothelial cells (ECs) play a prominent role in the pathogenesis of cardiovascular diseases by secreting cytokines. The purpose of this study was to clarify the role of mast cells as an activator of ECs.

Methods and Results— ECs harvested from human umbilical cord veins were stimulated with mast cell granules (MCGs) prepared from sonicated human leukemic mast cells. The supernatants and total RNA from cells were collected. Levels of interleukin (IL)-1β, tumor necrosis factor-α, and granulocyte colony-stimulating factor remained unchanged up to 24 hours. In contrast, levels of monocyte chemoattractant protein-1 (MCP-1) and IL-8 increased significantly within 6 hours. Northern blot analysis revealed an increase in MCP-1 and IL-8 mRNA expression in MCG-treated ECs. Induction of these chemokines was attenuated by antitryptase neutralizing antibody. Furthermore, MCP-1 and IL-8 were induced in ECs by incubation with human mast cell tryptase, but not with chymase.

Conclusions— These results indicate that the production of MCP-1 and IL-8 in ECs was induced by MCG and amplified by tryptase.

The role of mast cells in the pathogenesis of cardiovascular disorders has been recently highlighted. However, the mechanism remains unclear. This study demonstrates that degranulation of mast cells causes chemokine production in endothelial cells. These observations suggest the link between mast cells and atherosclerosis via endothelial production of chemokine.

Recent studies have showed that chronic infection, inflammation, and immunologic factors are closely associated with the development of certain cardiovascular disorders. Chronic inflammation increases the numbers of macrophages and T lymphocytes in atherosclerotic lesions. 1 Progression of lesions may also be associated with increased plasma concentrations of C-reactive protein, a marker of inflammation thought to be an early sign of atherosclerosis. 2 The immune response to viral infection may be a major source of dilated cardiomyopathy. The balance between inflammatory and antiinflammatory cytokines plays a pivotal role in the development of heart failure and of atherosclerotic lesions. Chemoattractant proteins (chemokines) are found in human atheromas, 3,4 and mice lacking chemokines or their receptors are less prone to atherosclerosis. 5–8 In addition, we have shown that the expression of monocyte chemoattractant protein-1 (MCP-1) is increased in the pressure-overloaded hypertrophied and failing heart. 9

Mast cells are essential resident effector cells in the elicitation of the immune response, found in nearly all major organs, near blood vessels in particular. 10 Recent studies have suggested that mast cells play a role in the progression of heart failure, atherosclerosis, and rupture of atheroma. 11–13

Mast cells are generally perivascular and may regulate endothelial cell (EC) function. ECs are a major source of various bioactive molecules, including cytokines and chemokines. This study tested the hypothesis that degranulation of mast cells by certain stimuli may regulate the production of cytokines from ECs and participate in the development of heart failure and of atherosclerotic lesions.

Methods

Biochemicals and Other Materials

Medium199 (M-199), grade I-A heparin sodium salt from porcine intestinal mucosa, human tryptase solution, N-benzoyl-D,L-arginine-p-nitroanilide (BAPNA), and N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (SAAPP) were purchased from Sigma Chemical Co (St Louis, Mo). Recombinant human chymase was obtained from Teijin Ltd (Osaka, Japan), and SF-8257 was from Suntory Biomedical Research Ltd (Osaka, Japan). Fetal calf serum and trypsin/EDTA were obtained from Life Technologies Inc (Grand Island, NY). Specific enzyme-linked immunosorbent assay kits for interleukin (IL)-1β, tumor necrosis factor-α, granulocyte colony-stimulating factor-, and granulocyte macrophage colony-stimulating factor were purchased from Otsuka Pharmaceutical Co (Tokushima, Japan), and kits for MCP-1 and IL-8 were from Toray Industries Inc (Tokyo, Japan). Neutralizing antibody against tryptase was purified as described previously. 14,15

Cell Culture

ECs were isolated from human umbilical veins as described previously 16 and cultured in M-199 supplemented with 20% heat-inactivated fetal calf serum, 90 μg/mL heparin, and antibiotics (penicillin, 50 U/mL streptomycin, 50 μg/mL and amphotericin B, 125 ng/mL). Cells at passages 3 or 4 were seeded on culture plates coated with 0.5% gelatin and incubated at 37°C in a humidified atmosphere of 5% CO2/95% air. After the monolayer had become confluent, the culture medium was changed to M-199 with 5% heat-inactivated fetal calf serum, and the cells were incubated overnight and mast cell granules (MCGs) were added. ECs were identified by their typical “cobblestone” appearance and staining factor VIII antigen by immunofluorescence. Human mast cell line 1 (HMC-1) (a kind gift of J. H. Butterfield, Mayo Clinic, Rochester, Minn) were cultured in Iscove’s modified Dulbecco’s medium (Life Technologies, Grand Island, NY) with 10% heat-inactivated fetal calf serum, 4 mmol/L l -glutamine, and antibiotics (penicillin, 50 U/mL streptomycin, 50 μg/mL and amphotericin B, 125 ng/mL) in a humidified atmosphere of 5% CO2/95% air. The cell number was adjusted to 5×10 6 cells/mL twice weekly by adding fresh medium.

Preparation of MCGs

MCGs were prepared as described previously. 17 Briefly, under sterile conditions, MCGs were obtained by bath sonication in ice for 5 seconds from HMC-1 (5×10 6 cells/mL) suspended in culture medium. The sonicate was then microcentrifuged (5 minutes) at 4°C, and debris-free supernatants were aliquoted and stored at −80°C. This solution was used as MCG and then added to human umbilical vein endothelial cells (ECs) incubated in a 24-well plate. To confirm that enzyme activities exist in MCG preparation procedure, we measured tryptase and chymase activity as described previously. 18 Tryptase activity was determined by its ability to cleave a synthetic substrate N-benzoyl-D,L-arginine-p-nitroanilide (BAPNA) 2 mmol/L in Tris-HCl 0.1 mol/L (pH 8.0) and glycerol 1mol/L at 410 nm. Chymase activity was determined spectrophotometrically (410 nm) by the rate of hydrolysis of N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (SAAPP) 0.7 mmol/L in NaCl 1.5mol/L and Tris 0.3mol/L (pH 8.0). Protease activity was expressed in milliunits per milliliter (mU/mL), in which 1 U of enzyme activity was defined as the amount degrading 1 μmol of substrate per minute at 25°C. Tryptase activity of MCG preparations used in the present study was 12.62 mU/mL, and chymase activity was 3.81 mU/mL.

Experimental Protocols

Measurement of Cytokine Production by Endothelial Cells

ECs, in a density of 500 cells/mm 2 , were incubated in complete medium and allowed to adhere in a 24-well plate for 48 hours. The medium was then changed to M-199 with 5% heat-inactivated fetal calf serum for a period of 24 hours. MCG were then added for up to 24 hours. The concentrations of IL-1β, tumor necrosis factor-α, IL-8, MCP-1, granulocyte colony-stimulating factor, and granulocyte macrophage colony-stimulating factor in the supernatant were measured by enzyme-linked immunosorbent assay and compared with those from control cells exposed to the HMC-1 solution for the same length of time, however, without previous sonication.

RNA Isolation and Northern Blot Hybridization

Total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform-isoamylalcohol procedure from ECs incubated with MCG for 0, 1, 6, or 24 hours, and Northern blot analysis was performed. 19 Equal amounts of RNA were electrophoresed on a 1.2% agarose/formaldehyde gel and transferred to a nylon membrane (Hybond-N+ Amersham Corp, Bunckinghamshire, England) by standard procedures. 20 The blots were sequentially hybridized with alpha- 32 P-dCTP–labeled cDNA probes for human MCP-1 and IL-8. After overnight hybridization, the membranes were washed with 2×SSPE/0.1% SDS at room temperature, 1×SSPE/0.1% SDS at 65°C, and 0.1×SSPE/0.1% SDS at 65°C. The blots were analyzed with a FUJIX bioimaging analyzer BAS 2000 (Fujix, Tokyo, Japan) and normalized to the corresponding 18S rRNA level.

Roles of Tryptase and Chymase on MCG-Induced Gene Expression and Production of MCP-1 and IL-8

In a series of experiments, antitryptase neutralizing antibody, nonimmunized control IgG, or the selective chymase inhibitor SF-8257 was added to the culture medium 1 hour before MCG stimulation to study the role of tryptase and chymase in MCG-induced production of MCP-1 and IL-8. The antitryptase antibody was used in concentrations of 0.001 to 10 μg/mL, control IgG in 10 μg/mL, and SF8257 in concentrations from 10 −7 to 10 −5 mol. SF8257 was confirmed to be effective in a concentration of 10 −5 mol.

Effects of Tryptase and Chymase on MCP-1 and IL-8 Production

ECs, in a density of 500 cells/mm 2 , were incubated in complete medium and allowed to adhere in a 24-well plate for 48 hours. The medium was then changed to M-199 with 5% heat-inactivated fetal calf serum for 24 hours. Tryptase in concentrations of 0.3 to 3 μg/mL or chymase in concentrations of 0.3 to 3 μg/mL was then added and the cells were cultured for up to 24 hours.

Statistical Analyses

Values are presented as mean±SEM. Results were analyzed by unpaired Student t test or by analysis of variance. P<0.05 was considered significant.

Results

MCG-Induced Cytokine Release

Figure 1 shows the mean levels of cytokines measured by enzyme-linked immunosorbent assay in 3 separate experiments. The levels of IL-1β, tumor necrosis factor-α, granulocyte colony-stimulating factor, and granulocyte macrophage colony-stimulating factor were not changed by MCG. In contrast, levels of MCP-1 and IL-8 were increased significantly by the addition of MCG when compared with control cultures. The MCP-1 and IL-8 levels from ECs stimulated by MCG for 24 hours were, respectively, 1.6±0.1-fold (P<0.05) and 16.4±0.3-fold (P<0.05) higher than those from cells kept static for 24 hours. The increased production of MCP-1 and IL-8 in ECs by MCG was apparent within 6 hours (Figure 2).

Figure 1. Effect of MCGs on the production of cytokines by ECs. Human umbilical vascular ECs (HUVECs) were cultured in medium 199 in the presence or absence of MCGs for 24 hours and the concentration of each cytokine in the supernatants was measured. Values are mean±SEM (n=3). *P<0.05 vs controls.

Figure 2. Time-dependent effect of MCGs on the production of MCP-1 and IL-8. HUVECs were cultured in complete medium 199 in the presence or absence of MCG for 0, 1, 6, and 24 hours, and the concentration of MCP-1 or IL-8 in the supernatants was measured. Values are mean±SEM (n=3). *P<0.05 vs controls.

Effects of MCG on Gene Expression of MCP-1 and IL-8

Figure 3 is a representative Northern blot showing the time course of mRNA levels of MCP-1 and IL-8. The MCP-1 mRNA level increased within 1 hour, peaked at 6 hours, and remained significantly increased at 24 hours. Densitometric analysis of the MCP-1 mRNA level normalized to the 18S rRNA showed a 2.2±0.3-fold increase in MCG-stimulated ECs at 6 hour compared with static controls. IL-8 mRNA level was also increased at 1 hour, peaked at 6 hours, and then returned toward baseline. Densitometric analysis of the IL-8 mRNA level normalized to the 18S rRNA showed a 2.4±0.4-fold increase in MCG-stimulated ECs exposed to MCG for 6 hours compared with static controls. MCP-1 and IL-8 mRNA levels of the controls unstimulated by MCG showed no significant change within 6 hour (Figure I, available online at http://atvb.ahajournals.org).

Figure 3. Time-dependent effect of MCGs on gene expression of MCP-1 and IL-8. Total RNAs were isolated from ECs incubated with MCGs for 0, 1, 6, or 24 hours, and Northern blot analysis was performed. The blots were sequentially hybridized with cDNA probes for human MCP-1 and IL-8. Corresponding 18S rRNA bands are shown as internal controls. Values are mean±SEM (n=3). *P<0.05 vs static controls.

Roles of Tryptase and Chymase on MCG-Induced Gene Expression and Production of MCP-1 and IL-8

Because mast cells contain a variety of mediators, including proteases, proteoglycans, and histamine, which could stimulate ECs to produce chemokines, an attempt was made to identify the factor that caused the production of MCP-1 and IL-8. Treatment of ECs with polyclonal antibody against tryptase at 1 μg/mL inhibited the MCG-induced production of MCP-1 and IL-8 (Figure 4A). Northern blot analysis showed that tryptase inactivation by antitryptase antibody, 1 μg/mL, inhibited the MCG-induced gene expression of MCP-1×48±16%, and of IL-8×74±19% (P<0.05 versus untreated controls Figure 4B Figure II, available online at http://atvb.ahajournals.org). The same concentrations of nonimmune polyclonal IgG altered neither the MCG-induced gene expression nor protein production of MCP-1 and IL-8 by MCG. Furthermore, selective inhibition of chymase by SF-8257, 10 −5 mol did not decrease the MCG-induced production of MCP-1 and IL-8 (Figure 4C). These results suggest that tryptase, but not chymase, plays an essential role in the MCG-induced gene expression of MCP-1 and IL-8.

Figure 4. Roles of tryptase and chymase on MCG-induced gene expression and production of MCP-1 and IL-8. ECs were pretreated with neutralizing tryptase antibody (0.001 to 10 μg/mL) (A) and SF-8257 (10 −7 to 10 −5 mol/L) (C), a chymase inhibitor, each for 1 hour before exposure of ECs to MCGs for 24 hours in analyzing protein levels and for 6 hours in examining gene expressions (B). Values are mean±SEM (n=3). *P<0.05 vs controls. Corresponding 18S rRNA bands are shown as internal controls.

Effects of Tryptase and Chymase on MCP-1 and IL-8 Production

Tryptase significantly increased the productions of MCP-1 and IL-8 in ECs within 6 hours of exposure (Figure 5A). There were dose-dependent releases of MCP-1 and IL-8 from ECs over a range of tryptase concentrations. In contrast, chymase did not modify the induction of MCP-1 and IL-8 (Figure 5B).

Figure 5. Time- and dose-dependent effect of proteases on the production of MCP-1 and IL-8. ECs were incubated in complete medium allowed to adhere for 48 hours, and then medium was changed to medium 199 with 5% heat-inactivated fetal calf serum for a period of 24 hours. Tryptase at concentrations of 0.3 to 3 μg/mL or chymase at concentrations of 0.3 to 3 μg/mL was then added and the cells were cultured for up to 24 hours. Values are mean±SEM (n=3). *P<0.05 vs controls.

Discussion

This study indicates that MCGs induce the production by human ECs of MCP-1, a potent chemoattractant for monocytes, and of IL-8, a potent chemoattractant for neutrophils, T lymphocytes, and eosinophils. These effects were mediated by human mast cell tryptase. The role of mast cells in the pathogenesis of cardiovascular disorders, heart failure and atherosclerosis in particular, has been recently highlighted. The number of mast cells is increased in the failing human heart 11 and in recently infarcted rat myocardium, 21 along with an increase in their mediators such as tryptase and histamine. We have previously shown that MCGs cause apoptosis of cardiomyocytes and proliferation of cardiac fibroblasts in vitro. 12 In addition, in infarct-related coronary arteries, the number of degranulated mast cells in the adventitia backing ruptured plaques is increased. 13 These observations suggest that mast cells and mast cell tryptase are activated in failing hearts and in atherosclerotic lesions.

Chemokines act mainly on neutrophils, monocytes, lymphocytes, and eosinophils, and play a pivotal role in the immune system. 22–26 The study of chemokines has recently expanded to fields well beyond immunology, and it has become evident that they play key roles in cardiovascular diseases. 27,28 MCP-1, a chemotactic factor for monocytes and one of the C-C chemokines, is believed to be among the important molecules involved in atherogenesis 5 and heart failure. 9 We have previously reported that plasma levels of MCP-1 are also increased in patients with acute myocardial infarction 29 and have shown that antibody against MCP-1 reduces myocardial infarct size in a rat ischemia/reperfusion model. 30 These data suggest that MCP-1, as an inflammatory mediator, plays a pivotal role in cardiac inflammatory responses in acute myocardial infarction. IL-8, a chemotactic factor for neutrophils and T lymphocytes, which belongs to the C-X-C chemokine family, may also play important roles in atherogenesis 31 and myocardial ischemia/reperfusion injury. 32

Several studies have reported an interaction between ECs and mast cells. ECs regulate the survival and development of mast cells, 33 and mast cell tryptase stimulates the production of IL-8 and the expression of IL-1β gene of ECs. 34 No longer regarded simply as a passive barrier separating the blood and surrounding tissue, ECs are now recognized as key players in the process of inflammation by producing various biomolecules, including cytokines and chemokines. Mast cells are localized at the adventitia in atherosclerotic coronary arteries. Adventitial inflammation is recognized as an important promoting factor of atherogenesis and the progression of arteriosclerosis. 35 Pro-inflammatory effects of adventitial mast cells on ECs seen in this study suggest that the mast cells can play a role in atherosclerosis by stimulating ECs as effector cells. Moreover, mast cell tryptase released from adventitia may influence the function of remote intimal ECs via vasa vasorum circulation. Our study is the first to show that the degranulation of mast cells causes the production of MCP-1 in ECs. This observation may explain the link between mast cells and the development of atherosclerosis and heart failure via the production of chemokine by ECs.

MCGs contain a wide variety of inflammatory mediators, the release of which depends on the stimulus. These mediators include histamine, cytokines, and proteases, which have various effects on neighboring cells. 36 Tryptase, chymase, cathepsin G, and carboxypeptidase are the major proteases contained in MCGs. 37 Tryptase plays a role as is a growth factor for a number of cell types, including fibroblasts, epithelial cells, and smooth muscle cells. 38 It may also be implicated in angiogenesis, because it induces tubular formation of ECs. 39

Chymase is closely associated with cardiovascular disorders. It is activated in pressure-overloaded hearts, is able to convert angiotensin I to angiotensin II independently of the angiotensin-converting enzyme, and plays a major role in the formation of angiotensin II. 40 Other proteases are known to have functions, which remain to be fully clarified.

The mechanism of chemokine production by ECs stimulated with mast cell tryptase is unclear. One possible mechanism involves activation of protease-activated receptors (PARs). Tryptase or thrombin cleaves the amino-terminal extracellular extension of the intact and inactivated receptor, exposing the amino terminus, which then functions as a receptor agonist, binding to a region of the receptor and activating it. Four subtypes of PAR have been cloned. The thrombin receptor (PAR-1) is expressed on ECs but does not appear to be activated by tryptase. PAR-2 is also expressed on ECs, and it may be activated by tryptase. 41 The effect of human mast cell tryptase on ECs inducing the production of chemokine may be mediated by this receptor. PAR-3 and PAR-4 can also be cleaved by thrombin. 42 However, little is known about the relationship between tryptase and these receptors.

In summary, we found that MCGs upregulate the secretion and gene expression of MCP-1 and IL-8 in human ECs. Human mast cell tryptase, but not chymase, is involved in the MCG-induced production of these chemokines. These results suggest that mast cells contribute to the pathogenesis of cardiovascular disorders, for instance by stimulating EC production of chemokines and enhancing local inflammation.

This work was supported by a research grant from the Ministry of Health and Welfare of Japan and a grant-in-aid for general scientific research from the Ministry of Education, Science, Sports, and Culture of Japan.


Molecular organization of rat prolactin granules: in vitro stability of intact and "membraneless" granules

Studies carried out on a number of secretory cell systems suggest that the specific cytoplasmic granules in which the secretion products are stored before their release are complex organelles which can possess a distinct molecular organization. For instance, it has been reported that in some granules the segregated secretion products are organized into crystalline structures (1-3) or large intermolecular aggregates (4-8). It is likely that all phenomena of this type are favorable to the economy of the cell, in the sense that they reduce the energy required for storage of the secretion products. The prolactin (LTH) granules of the rat pituitary possess a number of morphological features which strongly suggest that the molecules(s) of their content might be arranged in a relatively stable structure. Thus, these granules are remarkably polymorphic in shape, and their membrane is usually separated from their content by a clear space. Furthermore, identifiable LTH granules devoid of their membrane are often seen in the pericapillary space, suggesting that upon discharge by exocytosis they are dissolved only slowly (9). However, no studies specifically concerned with the mechanisms of LTH storage have been reported so far. In order to obtain some information on this question, we have studied the behavior of isolated granule fractions incubated in vitro under a variety of carefully controlled experimental conditions.


Studies on Morphological Changes and Histamine Release Induced by Bee Venom, n-Decylamine and Hypotonic Solutions in Rat Peritoneal Mast Cells

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Department of Histology, University of Umeå, the Department of Pharmacology, Karolinska Institutet, Stockholm, Sweden, and the Department of Connective Tissue Research Institute for Biological and Medical Sciences, Retina Foundation, Boston, U.S.A

Abstract

Histamine release and concomitant morphological changes in rat peritoneal mast cells were studied under various conditions. It was found that mast cells react somewhat differently, depending on the means by which histamine release was brought about. Bee venom produced effects similar to those of compound 48/80 and seemed to trigger an active cell process with extrusion of mast granules as a final result. n-Decylamine and hyposmotic solutions appeared to bring about histamine release by affecting the integrity of mast cell fine structure resulting in a breakdown of plasma membrane and cellular compartments.


GAGs and mast cell proteases

The proteases specific to mast cell granules are chymases, tryptases and carboxypeptidase A3 in human mast cells there is one chymase and a limited repertoire of tryptases compared with the numerous mouse enzymes [2]. In addition to these, several other proteases occur in mast cell granules but are not specific to them examples are cathepsin G, granzyme B [2], and cathepsin E, which cleaves the carboxypeptidase A precursor to give the active enzyme [38]. Proteases in mast cell granules are stored in their active forms [39]. The functions of mast cell proteases in inflammation and tissue repair [40], and those of protease-proteoglycan complexes in innate immunity [41] have been reviewed. These proteases are well recognised as pharmacological targets [42].

Mast cell protease storage is dependent on serglycin, and is moreover dependent on the presence of heparin and/or chondroitin, as demonstrated in NDST2 −/− mice that do not make the fully sulphated heparin structure [43, 44] and GalNAc4S-6OST −/− mice that cannot generate the CS-E structure [45]. No evidence has been reported that fully anticoagulant heparin, containing the 3-OST product sequence, is necessary for protease storage. Mouse CTMCs deficient in a combination of proteases have much reduced heparin, but unaltered chondroitin content [46]. Protease deficient, serglycin deficient, and heparin deficient mast cells all display altered granule morphology [43, 44, 46, 47].

In the mast cell granule, proteases and heparin are in intimate contact, so extensive heparin binding sites containing basic residues are expected on the surfaces of the proteases. For tryptases, dependent on heparin for activity and stabilisation of the tetrameric form [48], a plausible cross-linking geometry has been described for human β-II tryptase [49] (Fig. 4a) and a potentially heparin-binding linear area of basic character has been identified across two monomeric units in the tetramer of human α1-tryptase (Fig. 4b) [50]. Besides the active tetrameric form, stabilised by heparin, tryptases such as human β-tryptase and mouse mMCP-6 can also form active monomers in the presence of heparin, even if the heparin chain is too small to bridge two protein monomers (though heparin of such a low molecular weight is not likely to be found in vivo) [51, 52]. The minimum length of heparin for complex formation with tryptase tetramer is 20 monosaccharides [53]. The substrate selectivities for monomeric and tetrameric tryptases are different, and the monomeric form is susceptible to inhibition by protein inhibitors such as BPTI [51] in the tetrameric form the active sites of the four monomers face each other round a restricted space in the centre of the complex, restricting access to inhibitors that are proteins.

Heparin interactions with proteases a A β-tryptase tetramer crystal structure (1A0L.pdb), coloured by charge where blue is positive and red negative. This view clearly shows the restricted central active site. Clusters of basic residues, coloured blue, might accommodate a heparin chain binding to two monomers and so stabilising the active tetramer. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. b An α-tryptase tetramer crystal structure (1LTO.pdb), turned over by 90° to show the equivalent of the top face as compared with A). This view shows an almost continuous line of basic amino acid residues aligning with a long heparin molecule, shown in ball and stick format. Reproduced from [50] with permission. c A chymase monomer crystal structure (4KP0.pdb), showing clusters of basic amino acid residues (blue) on opposite sides of the charge-coloured surface, with a cluster of acidic residues (red) between them. The orientation of these two basic patches on the surface of chymase might allow this enzyme to pack between heparin chains of serglycin. The active site groove is on the left face of this diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc. d A granzyme B monomer crystal structure (1IAU.pdb) showing a substantial cluster of basic residues (blue) at the top of the charge-coloured surface. The active site is on the left face of the diagram. Diagram made in Discovery Studio Visualiser, Accelrys Software Inc

As the tetramer is most stable at low pH and in the presence of heparin, it has been proposed that tryptases are stored in the tetrameric form [54], and the presence of two separate, linear heparin binding sites on each tetramer, requiring long heparin chains, is compatible with the formation of closely packed complexes with heparin chains attached to a serglycin core. Depolymerisation of heparin, degranulation, and rise in pH could dissociate the tetramers to give heparin-activated, effective monomers, or inactive monomers as the heparin dissociates over time.

It is interesting to note that antithrombin is capable of inhibiting the monomeric active form of tryptase [55] so heparin can either activate the serine protease or potentiate its inhibition if all three are found together. Tetrameric, heparin-associated human tryptase can prevent coagulation and formation of fibrin deposits in inflamed tissue by cleaving fibrinogen [56].

For human chymase and granzyme B, typical heparin/HS binding sites can be identified. Chymase is active as a monomer, and does not require heparin for its activity. It has two separate well-defined patches of basic residues that may constitute heparin-binding sites, on opposite faces of the protein surface (Fig. 4c). There is only one human chymase (rodents have several), and its presence or absence determines the classification of human mast cells into MCTC mast cells, positive for both tryptase and chymase, and MCT cells, positive for tryptase only [2]. These two cell types are considered approximately equivalent to rodent CTMCs and MMCs, respectively. It is likely that this classification is an oversimplification of the true situation, at least in tissues like the lung [57]. Granzyme B has a particularly clear basic patch, shown on the protein surface in Fig. 4d. All of these potential heparin binding sites on the proteases have different sizes and shapes they may have different affinities for heparin, different abilities to bind to more than one heparin chain in the granule, different requirements in terms of heparin chain length, and even possibly different preferences for fine structure within heparin. It is also possible, of course, that preferences for CS/DS structures vs heparin structures differ between proteases.


Methods

Zebrafish stocks and embryos

Zebrafish were mated, staged, and raised as previously described 14 and maintained in accordance with University of California, San Diego Institutional Animal Care and Use Committee or Oregon State University Institutional Animal Care and Use Committee guidelines. The transgenic lines Tg(gata2:eGFP) la3 15 and Tg(mpx:eGFP) i113 16 were used.

Cell preparation

Single-cell suspensions from WKM and spleen were prepared from adult zebrafish as described. 15 Blood was obtained by heart puncture with heparinized tips after death in tricaine. Intraperitoneal exudate (IPEX) cells were collected via lavage with phosphate-buffered saline (PBS Mediatech). Four sequential washes using 5 μL of PBS were performed using a 10-μL syringe (Hamilton) for a total volume of 20 μL. Single-cell suspensions from other organs were prepared by manual trituration and filtration. Cell counts were performed using a hemacytometer (Hausser Scientific), using Trypan Blue (Invitrogen).

Flow cytometry

Cells were examined using a LSRII flow cytometer (BD Biosciences) as previously described. 15,17 Data were analyzed using FlowJo software Version 9.0.2 (TreeStar). Cells were purified using a FACSAria I (BD Biosciences).

Cytology

Cytospins were performed as described 15 using a Shandon Cytospin-4 (Thermo Fisher Scientific). Cells were fixed and stained with hematoxylin and eosin (Thermo Fisher Scientific), Wright-Giemsa (WG), myeloperoxidase (MPX), periodic acid–Schiff (PAS), or Toluidine blue (TB) according to the manufacturer's instructions (Sigma-Aldrich). Blood smears were stained with PAS, with hematoxylin as a counterstain.

Microscopy

Cytospins were imaged using a DP70 microscope (Olympus America). For transmission electron microscopy (TEM), cells were fixed in 3% glutaraldehyde in 0.1M cacodylate buffer. Cells were embedded in 12% gelatin/PBS and pelleted. Gelatin pellets were fixed in buffered 1% osmium tetroxide, washed, and dehydrated in a graded ethanol series and transitioned through propylene oxide. Samples were embedded in Embed 812/Araldite (Electron Microscopy Sciences). Thin (60-nm) sections were cut and mounted on parlodion-coated grids and stained with uranyl acetate and lead citrate for examination on a Philips-CM100 electron microscope (Philips/FEI) at 80 kV. Images were obtained using a Megaview-III camera (Olympus America) and processed using Adobe Photoshop CS.

Real-time quantitative polymerase chain reaction

RNA was obtained using Trizol (Invitrogen) according to the manufacturer's instructions. Genomic contamination was prevented by DNAse treatment (Roche Diagnostics). cDNA was prepared using a Superscript-III First-Strand kit (Invitrogen) with a separate control reaction with no reverse transcriptase. Quantitative polymerase chain reaction was performed using Brilliant SYBR Green master mix (Stratagene) and an Mx3000P System (Stratagene). Samples were amplified in triplicate. Reaction product size was confirmed by gel electrophoresis. Primers were designed with Primer3 software Version 0.4.0 18 or as indicated (ef1α, 19 gata2, 19 and mpx 19 ). dr-rnasel2: forward, TTCTGGGCTTTATTCACAAC reverse, TGAAAGAGAAGCTGAAGACC gcsfr, forward, TGAAGGATCTTCAACCACAC reverse, GGGAATTATAGGCCACAAAC ccr9, forward, AACCTCACTCACTCCTCAAAC reverse, CAGACCACCAGAGTGTTACC mhc2dab, forward, CAGGCCTACTTGCATCAATTG reverse, CAGACCAGATGCTCCGATG.

Preparation of the HpAg

Six female Swiss Webster mice (20 g, 6-8 weeks old) were gavaged with 150 H polygyrus third stage larva (L3) in 0.1-μm–filtered double-distilled water (ddH2O). At day 22 after infection, mice were killed and the small intestines were removed and cut into 3 sections in 0.15M NaCl, and incubated at 37° for 2 hours. Adult H polygyrus (> 200) were transferred with an eyelash pick into ddH2O in a microcentrifuge tube, pelleted for 45 seconds at 300g, washed, and repelleted. Adults were snap-frozen in liquid nitrogen and stored at −80°C. Extracts were prepared using a sonicator (Sonifier 450 Branson), and resulting suspensions were centrifuged at 4000g and sterile 0.22-μm filtered (Millipore). Protein concentration was determined using the bicinchoninic acid protein assay (Pierce Chemical). Extracts were stored at −80°C.

Degranulation assay

Cells were distributed in a 96-well plate and incubated for 2 hours at 32°C and 5% CO2 with media 20 containing HpAg or PBS, or lysed with 0.2% Triton-X gata2:eGFP hi cells were plated at 1 × 10 5 cells/mL. Cell-free supernatants were collected and added to 500 μL of o-phenylenediamine (OPD) (Sigma-Aldrich) in 0.05M phosphate-citrate buffer and 30% hydrogen peroxide to assess degranulation. 21 Reactions were stopped after 10 minutes with 4M H2SO4, and assayed by spectrophotometry (SPECTRAmax PLUS384) at 492 nm.

Sensitization assay

Transgenic gata2:eGFP animals were immunized weekly by intraperitoneal injection with 2 μg of papain (Sigma-Aldrich), or 0.5 μg of HpAg, emulsified in incomplete Freund adjuvant (IFA Sigma-Aldrich), followed by another intraperitoneal injection with emulsified antigen a day before the collection of tissues, after 1 or 4 weeks. Control fish were either treated by intraperitoneal injection with PBS in IFA (vehicle) or left untreated (uninjected). Single-cell suspensions from spleen and blood of treated and untreated fish were prepared as described in “Cell preparation.”

P tomentosa infection assay

P tomentosa infection of adult zebrafish was performed as described previously. 8 Fish were demineralized, and histologic sections of individual fish were prepared, with slides being stained with PAS to identify eosinophils. Infection was confirmed by observing the presence of developing larvae in the gut epithelia and lumen. Eosinophils were quantified by counting all nucleated PAS + cells visible in 25 individual high-power fields (1000× magnifications) of the gastrointestinal tracts of both infected and uninfected animals.

Statistics

Data were analyzed with 2-tailed Student t tests. Differences were deemed significant at P values less than .05.


Molecular cloning of human cathepsin G: structural similarity to mast cell and cytotoxic T lymphocyte proteinases

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

Note: In lieu of an abstract, this is the article's first page.