Information

What organism has the longest Hayflick Limit?

What organism has the longest Hayflick Limit?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Assuming I am understanding the concept correctly, Hayflick Limits are reflective of a cells capacity for stable division. Additionally, the Hayflick Limits of various organisms differs.

My question is, what organism has the longest Hayflick Limit? I know humans have one ranging from 40-60, just to give a bit context.


The Hayflick limit is generally associated with telomere length. Human telomeres are a little on the long side as species go, but are not extraordinary. Many species of mice, and other rodents, have far longer telomeres than humans, for example, and obviously have much shorter lifespans. There's also such a thing as a "mega-telomere", found in a number of bird species, which can hundreds of times longer than human telomeres.

There's only a vague correlation between telomere length and a species' lifespan. See Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination for a starting point. Telomeres are a part of the longevity story, but probably a fairly small part.

That said I don't see an explicit statement that those species with very long telomeres have a higher Hayflick limit. I assume this is because the Hayflick limit is an ultra-simplistic and not very useful description of a very specific set of conditions, but I don't know that for sure.


Reliability of proliferation controls. The Hayflick limit and its breakdown in cancer

This paper presents a new theory of the Hayflick limit and its role in cancer. The Hayflick limit is identified as a fail-safe mechanism that limits to harmless size descendent clones of cells in which normal proliferation controls have broken down. Malignancy arises when the Hayflick limit is inactivated. It is argued that the Hayflick limit is due to differentiation towards a non-proliferating state. Redundant developmental clocks are envisioned as the mechanism. Chemical carcinogens and promoters can interfere with these clocks. Also, viral gene products and integration of viral DNA can stop the developmental clock and lead to malignant transformation in cells that have already suffered mutations in their normal regulatory mechanisms that control proliferation. Viral transformation can be understood as a viral strategy of survival and transmission to a new host. Malignant clones may constitute a niche for many slow viruses. Normal functioning of the Hayflick limit implies senescence of tissues due to differentiation towards a non-proliferating state. Hence, the limit may be the cause of senescence even though it is not due to an accumulation of somatic mutations.


Contents

In the early 1970s, Russian theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends. [1]

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph G. Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. [2] Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase. [3]

In 1983, Barbara McClintock, an American cytogeneticist and the first woman to receive an unshared Nobel Prize in Physiology or Medicine, received the Nobel Prize for observing that the chromosomes lacking end parts became "sticky" and hypothesized the existence of a special structure at the chromosome tip that would maintain chromosome stability. [4]

End replication problem Edit

During DNA-replication, DNA polymerase cannot replicate the sequences present at the 3'-ends. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a primer to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of RNA) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see lagging strand replication). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) [note 1] would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. [5] It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70-100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50-100 base pairs per cell division. [6]

If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively degraded in the process of DNA replication.

The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most prokaryotes, relying on circular chromosomes, accordingly do not possess telomeres. [7] A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and Borrelia), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes. [8]

Telomere ends and shelterin Edit

At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1. [9] In many species, the sequence repeats are enriched in guanine, e.g. TTAGGG in vertebrates, [10] which allows the formation of G-quadruplexes, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in ciliates (that possess telomere repeats similar to those found in vertebrates) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes like DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription. [11]

Telomerase Edit

Many organisms have an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap." In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be reactivated and telomeres reset back to an embryonic state by somatic cell nuclear transfer. [12] The steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence [13] and in the prevention of cancer. [14] [15] This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. [16]

Length Edit

Telomere length varies greatly between species, from approximately 300 base pairs in yeast [17] to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. [18] These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins. [19] At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop. [20]

Role in the cell cycle Edit

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility. [21] If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Oxidative damage Edit

Apart from the end replication problem, in vitro studies have shown that telomeres accumulate damage due to oxidative stress and that oxidative stress-mediated DNA damage has a major influence on telomere shortening in vivo. There is a multitude of ways in which oxidative stress, mediated by reactive oxygen species (ROS), can lead to DNA damage however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. [22] Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. [23] Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. [24] These results [25] suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Association with aging Edit

Telomere shortening is associated with aging, mortality and aging-related diseases. Normal aging is associated with telomere shortening in both humans and mice, and studies on genetically modified animal models suggest causal links between telomere erosion and aging. [26] However, it is not known whether short telomeres are just a symptom of senescence or if they themselves contribute to the progression of the aging process. [27]

The age of a father plays a role in the length of a child’s telomeres, which has evolutionary implications. Although leukocyte telomeres shorten with age, sperm telomeres lengthen with age. Shorter telomeres are theorized to impose lower energy costs (due to less replication) but also have immune system-related and other aging- and disease-related costs, so the effect of paternal age on telomere length might be an adaptation to increase the chances that the child will be fit for the environment they’re born into. [28] [29]

Potential effect of psychological stress Edit

Meta-analyses found that increased perceived psychological stress was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for publication bias. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. [25] [30] A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life. [31]

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. [32] [33] Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West, that tied telomere shortening with the Hayflick limit. [34] The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells. [35]

It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. The reason that this would extend human life is because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed (Turbill, et al. 2012 & 2013) and that hibernation prolongs life-span (Lyman et al. 1981). It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice [36] [37] and the nematode worm species Caenorhabditis elegans. [38] It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002 [39] ). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption. [21]

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. [40] In 2006, Juola et al. [41] reported that in another unrelated, long-lived seabird species, the great frigatebird (Fregata minor), telomere length did decrease until at least c. 40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial. [42] Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. [43] Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence. [44]

Known, up-to-date telomere nucleotide sequences are listed in Telomerase Database website.

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG [45]
Allium CTCGGTTATGGG [46]
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Telomeres are critical for maintaining genomic integrity and may be factors for age-related diseases. [47] Laboratory studies show that telomere dysfunction or shortening is commonly acquired due process of cellular aging and tumor development. [47] [48] Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue. [49] [50]

Observational studies have found shortened telomeres in many types of experimental cancers. [51] In addition, people with cancer have been found to possess shorter leukocyte telomeres than healthy controls. [52] Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres. [53] [54] However, the increase in risk varies by age, sex, tumor type, and differences in lifestyle factors. [51]

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. [55] [56] A Real-Time PCR assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell. [57]

Tools have also been developed to estimate the length of telomere from whole genome sequencing (WGS) experiments. Amongst these are TelSeq, [58] telomereCat [59] and telomereHunter. [60] Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. Flow-FISH is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006. [61]

While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. [62] [63] Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company, promoted the clinical utility of telomere length measures. [64]

Most research on telomere length and regulation, and its relationship to cancer and aging, has been performed on mammals, especially humans, which have little or no somatic telomerase production. Ectotherms are significantly more likely than endotherms to have variation in somatic telomerase expression. For instance, in many fish, telomerase occurs throughout the body (and associated with this, telomere length is roughly the same across all its tissue). Studies on ectotherms, and other non-mammalian organisms, show that there is no single universal model of telomere erosion rather, there is wide variation in relevant dynamics across Metazoa, and even within smaller taxonomic groups these patterns appear diverse. Due to the different reproductive timelines of some ectotherms, selection on disease is relevant for a much larger fraction of these creatures’ lives than it is for mammals, so early- and late-life telomere length, and their possible links to cancer, seem especially important in these species from a life history theory point of view. [65]


Higher organisms like we humans are made of cells, of several hundred distinct types if you exclude all of the symbiotic bacterial species that we carry along with us. The vast majority of cells have short finite life spans: they stop reproducing and self-destruct or become senescent after a number of reproductive divisions. You might be familiar with the Hayflick limit in relation to this topic: it is the number of times a cell divides before it removes itself from the cell cycle to a fate of destruction or senescence. Similarly you have probably heard of telomeres, the repeating DNA sequences at the end of our chromosomes. The length of telomeres shortens with each cell division, forming a sort of countdown clock, and too-short telomeres is one of mechanisms by which cell division is halted.

The reality on the ground is much more complex than this simple view of a cell division countdown. Some cells don't divide and last you a lifetime, such as many of those in the central nervous system. Other cells, such as stem cell populations, have their telomeres repeatedly extended by the enzyme telomerase. Different cells in different parts of the body have very different life spans, and the complex array of processes that determine those life spans is highly variable, reacting to the environment and to each other.

None of this really has much direct bearing on the life span of an organism, however. You can't just wave a wand that would extend the life of all cells, and expect to see a similar extension of life in the organism - whether that happens or not depends on the intricate details of how cells relate to organs and systems. The life span of cells is all the way down there in the depths of the machine, details internal to low-level components that are decoupled from how the machine behaves in aggregate. There is no particular reason for cell life spans to have anything to do with how long the machine as a whole can last. Some of our tissues are designed to cycle through and replace all of their cells very rapidly, in a matter of days. Other cells are never replaced and live as long as we do.

Cell behavior is subordinate to the needs of the organ or system that they are a part of. The cells of a given type evolved to have their present behavior and typical life spans because, when acting as a system in conjunction with other cell types, they produce a working organ or system that provides some evolutionary advantage. If that can be done with lots of cell turnover and short cell life spans, it will be. If it can be done with little cell turnover and long cell life spans, it will be also - but either path can produce a long-lived and reliably functional organ. This point is one that a recent article comes to eventually, after a tour of the Hayflick limit and telomere biology:

It is true that as we get older our telomeres shorten, but only for certain cells and only during certain times. Most importantly, trusty lab mice have telomeres that are five times longer than ours but their lives are 40 times shorter. That is why the relationship between telomere length and lifespan is unclear.

Apparently using the Hayflick limit and telomere length to judge maximum human lifespan is akin to understanding the demise of the Roman empire by studying the material properties of the Colosseum. Rome did not fall because the Colosseum degraded the Colosseum degraded because the Roman Empire fell.

Within the human body, most cells do not simply senesce. They are repaired, cleaned or replaced by stem cells. Your skin degrades as you age because your body cannot carry out its normal functions of repair and regeneration.

The processes that cause degenerative aging occur at the level of cells and specific protein machinery within cells, harming their ability to perform as they should. Old, damaged cells produce more old, damaged cells when they divide. Old, damaged stem cells simply fail to keep up with their tasks of tissue maintenance. Long-lived cells become progressively more damaged and incapable, or die back, either of which causes very visible issues when it happens in the nervous system and brain.

Aging is simply a matter of damage. But how that damage translates into system failure is not a straightforward matter of cells living longer or cells dying sooner - except when it is for some long-lived cell types. Every tissue fails through the same general processes, but those processes produce a very wide range of failure modes, depending on the character of the tissue and the cells that make it up. Go beyond the comparative simplicity of the root causes of aging, and everything becomes progressively ever more complex as you move towards describing the highly varied biology of fatal age-related diseases. This is why intervening in the root causes is absolutely the best and most cost-effective strategy, the only one likely to produce meaningful progress towards human rejuvenation in our lifetimes.

As a final note, for my money, I'd wager that forms of amyloidosis are the present outermost limiting condition on human life span. The evidence suggests that this is what ultimately kills supercentenarians, the resilient individuals who have made it past the age of 110, avoiding or surviving all of the fatal age-related medical conditions that claimed their peers.

I love reading these articles here. I try to read every single one. However, I wish that all you science guys agreed with each other a little more often. You say that telomere erosion has little to do with aging. This guy says that it has everything to do with it. Oh, I wish that I had spent more time studying biology. Heh heh. This is from the article: "In other words, telomere dysfunction is not just one culprit in the declining health of advanced age. It’s the kingpin, according to DePinho and his colleagues."

@Nathan Voodoo: I think telomere length is plausibly a secondary feature of aging. Other people disagree. It's also possible for shorter telomeres to be a secondary effect of the actual primary causes of aging and then still go on to cause a bunch of tertiary problems - so keeping them long might stop the tertiary problems while still not doing much for the course of aging in general.

It's all still open to a rigorous determination one way or another.

There are mouse studies in which boosted telomerase (and thus longer telomeres) lengthens life, but it's not a given that the reason this lengthens life is lengthening telomeres. Telomerase does a bunch of other things as well.

You might bear in mind that several telomere length measuring companies are getting venture funding now, or have obtained it recently, and so that's going to have an effect on what the press is saying. Think back to what the press was saying about resveratrol and sirtuins when there was a lot of venture funding for that research - in general you'll see more articles that exaggerate the importance of the mechanisms and science involved in the work of the venture funded companies. That's just the way the world works.

Most every popular article and almost every paper talks only about absolute telomere length, not the parameter that is likely far more important – the rate of erosion, also known as TROC, telomere rate of change. See, for example:

Thanks for the response. I will look into these things that you have mentioned.


Access options

Get full journal access for 1 year

All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.

Get time limited or full article access on ReadCube.

All prices are NET prices.


U S C M A – United States Colombian Medical Association

Did biology evolve a way to protect offspring from the ravages of aging by creating a physical barrier that separates the parent from its young?

he idea that every organism must age was a concept that surprised many biologists. For a long time, aging was thought to be a process occurring only in multicellular organisms. The reason for this arguably odd presumption was that we knew somatic cells—such as those that comprise the kidney, brain, and liver—lost their functionality over time: they aged. Furthermore, those cells divided only a limited number of times, around 50, after which they reached the so-called Hayflick limit, stopped proliferating, and died.

Unicellular organisms were thought to be capable of dividing forever, as long as conditions allowed: one generation begetting the next down through time—a sort of immortality. If unicellular organisms were like somatic cells, then they would age as they divide, reach the Hayflick limit, and die.

It wasn’t until the 1950s that researchers who thought about aging began to change their minds. It became clear that the daughter cells of some unicellular organisms seemed to rejuvenate, to start from scratch, while the mother cells accumulated the cellular aberrations that signaled aging. This pattern of aging was seen in such evolutionarily distant organisms like Saccharomyces cerevisiae, known as budding or baker’s yeast, and bacteria such as Caulobacter crescentus and Escherichia coli. 1–3 Aging, it seems, is a universal property of all living beings.

For me, that realization begged a more fundamental question, one that as biologists, we are scarcely allowed to ponder: Why do cells allow some mistakes to accumulate? If evolution is such a powerful process—one that finds solutions to all manner of problems—how could there be processes or problems that can’t be fixed?


Telomeres - Biological Clock

In principal, bacteria can live forever. If a bacterial cell is housed in good conditions it will continue to divide and increase in size indefinitely. Cells of higher organisms like birds or mammals work slightly differently. Until the middle of the 20th century, it was believed that cells in all species could also live forever. However, in 1912, a scientist at the Rockefeller Institute named Alexis Carrel performed a study designed to study the length of time a chicken fibroblast would divide for. Fibroblasts are the connective tissues cells that increase the strength of the three dimensional framework that is the main support of other cells. Carrel fed the cells a broth that was made from chicken embryos, feeding them on a regular basis. Excess cells were discarded on a periodic basis. The fibroblasts continued to divide for years without any sign of slowing until 30 years later when the experiment was ended (after Carrel's death). It showed that in a specially controlled environment the cells of higher organisms can also be immortal.

It took until the 1960's for a study that conflicted with Carrels results to be done. Leonard Hayflick's study of human fibroblasts, maintained in a similar set of conditions to those of Carrel, would only divide about 50 times and then cease. Which one had the more valid methods? It seems that it was Carrel's experiment was the flawed one. Because the nourishing broth that he used to feed the cells had a low level content of chicken fibroblasts he was inadvertently adding new cells on a regular basis. This problem was resolved by Hayflick who showed that there was a maximal number of divisions that a cell could make in controlled conditions this came to be known as the Hayflick limit.

The Hayflick limit can be considered a genetic program that limits the number of times a cell can divide. The reason for this limitation is that it reduces the likelihood of uncontrolled cell growth that can result in cancer. Several studies have shown that in cancer cells the genetic clock doesn't have a time limit thus allowing the cells to divide indefinitely.

Over time, the reason for the Hayflick limit was discovered. Chromosomes in higher organisms are capped with telomeres which are a special kind of DNA structure. The primary purpose of the telomeres is to prevent the ends of the chromosomes from degenerating. The process of DNA replication is what happens when the chromosomes are duplicated through cell division. Due to the way this process works, the tips of the telomeres cannot be effectively replicated. This means that the telomeres grow progressively shorter after each time the cell divides. It seems that once the cells telomeres have reached a certain length the cell ceases to be able to divide. (This isn't the case in bacteria because they have circular cells that do not include telomeres). After approximately 50 divisions, the fibroblasts not only cease to be able to divide by them also take on a different "look" and behavior. The metabolic rates of the fibroblasts slow down they grow in size and also accumulate lipofuscin which is the pigment that causes age spots. This is known as cellular senescence.

Could aging be explained as what happens once cells have reached the Hayflick limit and are no longer able to divide? There is no conclusive answer to that question at this time. It seems that in certain tissues, including the skin and the lining of blood vessels the Hayflick limit may be a key to the aging process. An example is the increased advancement of vascular diseases with age that might be in part caused by the decreased ability of vascular epithelial cells to divide. The Hayflick limit may also be a factor in age related changes to the skin as an increased number of dermal fibroblasts attain the state of senescence. Yet interestingly, the brain cells as well as cells in the nerves, muscles and retina do not normally divide, which means that they would not reach the Hayflick limit.

The Hayflick limit does not apply to all cells. Germ cells (the cells that turn into ova or sperm) and cancer are obviously immortal. Embryonic stem cells (and possibly some adult stem cells) also have the potential to be long lived or even immortal. When a store of immortal stem cells is present in certain tissues (such as skin) the buildup of dysfunctional cells that reaches the Hayflick limit seems to be a problem. The majority of cells do not die when they reach the Hayflick limit rather they enlarge and lose the majority of their practical functions. They also slow, and can cause problems with younger cells. It has been observed that the skin of older people has three times as many senescent fibroblasts then that of younger people. The accumulation of senescence and its resulting loss of capacity can have an effect on a number of different tissues.

There is a way to override the Hayflick limit. Certain mutations in cancer cells do indeed override the Hayflick limit. There are also certain viruses that have a similar effect. These viruses include the papilloma virus that immortalizes the cells that it infects. A cellular mechanism that overrides the Hayflick limit has been discovered. There is a particular gene that encodes an enzyme (telomerase) which has the ability to restore shortened telomere. The cells in which telomerase has had an effect appear to be immortal. Most normal cells have a more suppressed telomerase activity which keeps them from dividing beyond a certain limit. Scientists have discovered that in embryonic stem cells the Nanog gene is activated thus making them immortal. INKa is another gene that is an active part of senescence. INKa's role is to encode the P16 protein which helps to prevent cancer by inducing cellular senescence. Mice that have P16 were proven to have less senescent cells then there are in regular mice. The tissues of these mice have more regenerative capacity with age. At the same time the mice with less P16 had a reduced lifespan due to a higher rate of cancer.

The Hayflick limit has an effect on age related changes and certain tissue based diseases (primarily based in the blood and skin). Eradicating the Hayflick limit would cause increase the possibility of cancer. It also seems that the number of times a cell dives before it hits the limit is not prescribed. Various environmental factors can accelerate or retard the cellular clock. Raised levels of free radical formation have been proved to shorten the Hayflick limit. Other substances have been shown to extend the limit in certain types.

How can the effect of the cellular clock be minimized when it comes to the aging process? Research is beginning to show that we will be able to use genetic engineering to alter the system that produces the Hayflick limit. This is still in the experimental stages and the problem with it at the moment is that it seems that the side effects would be an increased possibility of cancer. Scientists are also looking into a way to remove senescent cells from the tissues without causing any residual damage. At the moment all that we can do is avoid unnecessary cell division. Avoiding these cell divisions can be done by lowering exposure to the factors that cause it. All kinds of cellular stress and tissue damage can result in cell division. This is particularly true of free radicals, inflammation, mutagens, certain toxins and UV radiation all of which have been proved to raise levels of cell division. Antioxidants appear to have the opposite effect. Garlic extract might be a regular everyday substance that can limit the Hayflick limit to a small extent. More clinical studies are required to prove its practical effects.


Contents

Belief of cell immortality

Prior to Hayflick's discovery, it was believed that vertebrate cells had an unlimited potential to replicate. Alexis Carrel, a Nobel prize-winning surgeon, had stated "that all cells explanted in culture are immortal, and that the lack of continuous cell replication was due to ignorance on how best to cultivate the cells". He supported this hypothesis by having cultivated fibroblasts from chick hearts, and to have kept the culture growing for 34 years. [ 3 ] This indicated that cells of vertebrates could continue to divide indefinitely in a culture. However, other scientists were unable to reproduce Carrel's result.

In fact, Carrel's result was due to an error in his experimental procedure: chick embryonic stem cells were added to the culture daily. This allowed for the cultivation of new fresh cells in the culture, and not simply the infinite reproduction of the original cells present in the culture. [ 1 ] It has been speculated that Carrel knew about the error, but he never admitted it. [ 4 ] [ 5 ]

Experiment and discovery

Dr. Leonard Hayflick first became suspicious of Carrel’s theory while working in a lab at the Wistar Institute. Hayflick was preparing normal human cells to be exposed to extracts of cancer cells when he noticed the normal cells had stopped proliferating. At first he thought that he had made a technical error in preparing the experiment, but later he began to think that the cell division processes had a counting mechanism. Working with Paul Morehead, he designed an experiment that showed the truth about normal cell division.

The experiment proceeded as follows. Hayflick and Morehead mixed equal numbers of normal human male fibroblasts that had divided many times (cells at the 40th population doubling) with female fibroblasts that had divided only a few times (cells at the 10th population doubling). Unmixed cell populations were kept as controls. When the male ‘control’ culture stopped dividing, the mixed culture was examined and only female cells were found. This showed that the old cells ‘remembered’ they were old, even when surrounded by young cells, and that technical errors or contaminating viruses were unlikely explanations as to why only the male cell component had died. [ 1 ] [ 6 ] The cells had stopped dividing and become senescent based purely upon how many times the cell had divided.

These results disproved the immortality theory of Carrel and established the Hayflick Limit as accredited biological theory which, unlike the experiment of Carrel, has been reproduced by other scientists.


The Hayflick limit has been found to correlate with the length of the telomeric region at the end of chromosomes. During the process of DNA replication of a chromosome, small segments of DNA within each telomere are unable to be copied and are lost. ⎖] This occurs due to the uneven nature of DNA replication, where leading and lagging strands are not replicated symmetrically. ⎗] The telomeric region of DNA does not code for any protein it is simply a repeated code on the end region of linear eukaryotic chromosomes. After many divisions, the telomeres reach a critical length and the cell becomes senescent. It is at this point that a cell has reached its Hayflick limit. ⎘] ⎙]

Hayflick was the first to report that only cancer cells are immortal. This could not have been demonstrated until he had demonstrated that normal cells are mortal. Α] Β] Cellular senescence does not occur in most cancer cells due to expression of an enzyme called telomerase. This enzyme extends telomeres, preventing the telomeres of cancer cells from shortening and giving them infinite replicative potential. ⎚] A proposed treatment for cancer is the usage of telomerase inhibitors that would prevent the restoration of the telomere, allowing the cell to die like other body cells. ⎛]


CINEMA SCIENCE: The Dangerous Biology of Annihilation: A thought-provoking, high-concept sci-fi thriller, Alex Garlands film touches on real-world phenomena such as Hox genes, the Hayflick limit and the Mandelbrot set. While its science is complex and its subject matter can be intense, the film provides many excellent opportunities for discussions about biology in senior secondary classrooms, as DAVE CREWE describes.

Typically, the films selected for Cinema Science are relatively mainstream--movies you can expect the average high school student to have heard of, if not seen. Annihilation (2018) is different. Despite its formidable pedigree (written and directed by Alex Garland, starring the likes of Natalie Portman, Jennifer Jason Leigh and Tessa Thompson), this sci-fi film proved too cerebral for Paramount, which infamously dumped the end product onto Netflix. Consequently, Annihilation only received a theatrical release in North America and China (1)--hardly the typical trajectory of a mainstream movie.

But Annihilation boasts something not necessarily shared by its blockbuster competitors: accessibility. Some 38 per cent--and rising--of the Australian population have access to Netflix, (2) so many of your students will be able to watch Annihilation. even if they haven't yet. Annihilation also possesses a robust scientific spine adapted from Jeff VanderMeer's eponymous 2014 novel and inspired by thoughtful sci-fi forebears like Stalker (Andrei Tarkovsky, 1979), (3) 2001: A Space Odyssey (Stanley Kubrick, 1968) (4) and The Thing (John Carpenter, 1982), (5) Garland's film slithers through cellular biology, optical phenomena and our genetic code on its way to a decidedly ambiguous conclusion.

Annihilation is best suited to senior secondary Science classrooms, both for the complexity of its scientific subject matter and for the graphic nature of its content: the film features some gory and legitimately horrific scenes.

Annihilation's protagonist, Lena (Portman), is a professor at Johns Hopkins University researching 'the genetically programmed life cycle of a cell'. (6) That research isn't what leads her into the 'Shimmer'--an iridescent, extraterrestrial area. She's there searching for clues to save her husband, Kane (Oscar Isaac), a soldier who's the first to safely return from within the Shimmer but is shortly thereafter afflicted with an unexplained ailment. But Lena's knowledge of cells proves crucial to understanding the nature of what's occurring within the Shimmer, just as cellular biology reveals itself as the thematic and narrative foundation of the film.

That's reflected in something as simple as the short scene showing Lena teaching a class. 'All cells were ultimately born from one cell,' she tells her students.

A single organism, alone on planet Earth, perhaps alone in the universe. About 4 billion years ago, one became two. Two became four. Then eight, sixteen, thirty-two. The rhythm of the dividing pair, which becomes the structure of every microbe, blade of grass, sea creature, land creature and human. The structure of everything that lives. and everything that dies.

This scene could be used as stimulus for a lesson on cellular division - not just in a Biology or a Mathematics classroom, where you might model the exponential growth of a dividing cell.

As teachers, we become proficient at spinning simple stimuli like this scene into an extended exploration of a topic within the curriculum, allowing the germ of an idea to - much like a dividing cell - multiply into bigger and more sophisticated concepts. Annihilation's interest in the cell and its reproductive process extends beyond this short scene. Within the Shimmer, on more than one occasion Lena observes an apparently normal cell split into a second one: a cell pulsing with colour, its rainbow cilia flailing. At the film's climax, Lena encounters the 'Entity': an enigmatic organism that mimics her movements. We watch it form from a single cell dividing, growing and, ultimately, mirroring its progenitor. At its thematic core, the film features the key processes of reproduction: doubling, mirroring, mutation.

Annihilation is a perfect starting point to explore how intimately mutation is intertwined with such reproductive processes. The film is filled with extraordinary, inexplicable mutations. Some of these are beautiful, as when a single plant sprouts into a bounty of colourful flowers, or different species grow from the same root. Lena stumbles upon an elk with flowers sprouting from its antlers and then watches as - almost imperceptibly--it splits into a second elk. (7) More often, the mutations are horrific: An albino crocodile's maw filled with shark's teeth. Human intestines contorting into writhing eels. A terrifying bear-like creature mimicking the screams of its human victims.

These mutations aren't realistic, necessarily they represent the power of the Shimmer - and its threat. As a jumping-off point, though, these transformations allow for discussion around the intersection of cellular division, mutation and evolution. Without the imperfections in this process, we would've never progressed beyond simple organisms. The alacrity of the mutations within the Shimmer, then, suggests the magnitude of the threat offered to our species, even as Garland keeps his cards close to his chest regarding the Shimmer's nefarious intentions--or lack thereof. (8)

One of the film's most enduring images is a family of trees awkwardly arched into human poses, branches grasping like arms - skeletons that never were bodies, solid shadows of humanity. One of the scientists accompanying Lena into the Shimmer, Josie (Thompson), offers a hypothesis: 'Do you know what you'd get if you sequenced [that leaf]? [. ] Human Hox genes.' Lena explains that Hox genes 'define the body plan, the physical structure'.

That isn't quite how human Hox genes work you wouldn't expect a tree to grow into a person thanks to a bit of gene splicing. But it resembles reality closely enough to prompt classroom discussions and/or investigations. As Dr Adam Rutherford--scientific adviser on Annihilation (as well as on Garland's previous film, 2014's Ex Machina) - puts it, Hox genes 'lay out the polarity of the organism': 'When [Josie] is talking about them, she's trying to rationalize how you could be seeing plants growing in human form, because that runs counter to our own scientific understanding of the gene.' (9) There's more than enough material here to allow for a research project wherein students explore the properties of Hox genes and how they're represented in Annihilation.

Another question worth investigating: could we make cells immortal? No, I'm not engaging in idle conjecture this is a question posed within the film itself. In a pre-Shimmer flashback, Lena explains the notion to her husband: 'You take a cell, circumvent the Hayflick limit, you can prevent senescence [. ] It means the cell doesn't grow old it becomes immortal.' Sure sounds like science fiction, but this isn't entirely outside the realm of possibility.

The Hayflick limit Lena is referring to describes cells' inability to divide forever. Each time a cell undergoes mitosis, its telomeres--genetic sequences found at the ends of chromosomes --degrade until, eventually, the consistency of the chromosome deteriorates beyond the point where reproduction can continue. Ageing, dying: senescence. But not all cells are subject to this phenomenon. In fact, the cell division Lena shows her class is that of a HeLa cell, (10) an 'immortal' cell discovered in 1951 and subsequently widely used in scientific research due to its resistance to senescence.

* Lobsters are sometimes described as 'immortal' as their cells don't experience senescence. Evaluate this claim.

* How do Hox genes work? Is their representation in Annihilation scientifically accurate?

* What are the different types of cellular division?

CANCER AND SELF-DESTRUCTION

Alex Garland has said that he starts his films with a central idea. For Annihilation, it was self-destruction, so it's no coincidence that Lena has the profession she does and works with cancer cells.

The HeLa cell isn't just any cell. It stems from a sample of cervical cancer cells taken from Henrietta Lacks, after whom the cells were named. And, while it's interesting to explore the ramifications of immortal cells both inside and outside the context of Annihilation, the HeLa cell mostly closely resonates with Garland's intentions because of its cancerous origins.

Fundamentally, Annihilation is a film about cancer. It's a film about unbridled growth and mutation, a film about how something as apparently innocent as cellular division can manifest itself as something terrifying, something fatal. The screenplay is dotted with explicit references to cancer in humans: Cass (Tuva Novotny) lost her daughter to the disease, while Dr Ventress (Leigh) has herself been diagnosed with terminal cancer. I regard these as Garland's signposts, providing his audience with a framework to make sense of an often-confusing narrative.

To understand these signposts, one needs to understand the properties of cancer itself. As explained by the Australian Cancer Council, cancer is a disease of the body's cells. Normally cells grow and multiply in a controlled way, however, if something causes a mistake to occur in the cells' genetic blueprints, this control can be lost. Cancer is the term used to describe collections of these cells, growing and potentially spreading within the body. (12)

Essentially, cancer is a genetic error - much like the mutations that drive evolution - that turns our cells' multiplicative tendency against us. In other words: self-destruction.

The antagonist of Annihilation--the Entity, the Shimmer, whatever you want to call it--embodies these mechanics. The influence of the Shimmer is mutative, twisting and warping genetic code. But the Entity itself, which mirrors Lena's and Kane's movements and assumes their forms, strikes me as cancerous on a global scale. While the Entity's intentions remain unclear, the conclusion of the film, with Entity-Kane and Lena (perhaps herself an offshoot of the Entity) tentatively reunited, suggests that it exists to reproduce and consume Earth organisms--including, naturally, humanity.

Cancer is a fascinating subject for any Biology classroom. To examine cancer is to understand the incredible potential of our biological processes and the multivalent possibilities of mutation, but also to recognise the threat of unbridled reproduction. Understanding cancer is more than academic, of course. The better we understand a disease, the better we can fight it. Recognising that cancer is, fundamentally, our own cells turned against us will allow students to comprehend the need for debilitating treatments like radiation therapy, whereby we poison our cells in order to fight the cancer.

'The cure for cancer' remains science's holy grail, so why not spend a lesson--or an entire assessment task - with your class exploring scientists' attempts to refine cancer treatments. Just recently, for instance, a woman was cured of advanced breast cancer through a trial that used gene therapy to, in essence, rewrite her immune system to target the cancer cells specifically. As reported by New Scientist, 'It's the first time this type of therapy has worked in breast cancer, suggesting that it may be able to help many more people with common types of cancer'. (13) Understanding this therapy requires a sophisticated grasp of genetics, the human immune system and cancer--an excellent opportunity for a senior secondary Biology activity.

* What kinds of methods are currently used to treat cancer? What are the limitations and side effects of these treatments?

* How is cancer an example of 'self-destruction'?

For me, the most enduring image of Annihilation isn't the iridescent sheen of the Shimmer, nor the corrupted bear-creature that stalks our heroines. Rather, I remember the simple, repeated shot of a hand (or hands) through a glass of water, reflected by the bending of the light. This mundane inversion characterises the sensation of watching Annihilation, seeing the ordinary flipped into something ambiguously sinister.

There's nothing miraculous about these images. They're a simple example of how refraction can cause reflection, as the light bends while travelling through the glass and the water within. It's trivially easy to replicate this phenomenon with your class all you need is a glass of water and a piece of paper. (14) Draw an arrow - or any shape for which the reflection will be obvious--and observe it through the water. From the right vantage point, the image will be reflected horizontally. But ask your students to adjust the position of the paper, the glass and/or themselves, and they should find that it isn't always reflected.

This simple experiment is an engaging introduction to a Physics unit on optics - specifically, refraction. Investigating this phenomenon requires an understanding of refractive index, focal points and other key features of optics. Linking back to Annihilation, you could tie these principles into the multicoloured appearance of the Shimmer: we observe similarly colourful displays in, say, soap bubbles. The applications for these phenomena are manifold for instance, without the principles of refraction, we wouldn't have access to the optical-fibre technology that powers the fast internet that allows you to stream Annihilation in HD--well, depending on your provider. (Rather cleverly, Garland and director of photography Rob Hardy incorporate refractive phenomena into the very look of the film. For example, they're not shy about keeping lens flares in their shots--flares caused by the refraction of bright light.)

Refraction is referenced in Annihilation outside of these moments. It's offered as an explanation for why the squad can't communicate outside the Shimmer with their radios. As Josie explains, 'The light waves aren't blocked they're refracted, and. it's the same with the radios. Signals aren't gone. They're scrambled.' She extrapolates this observation to apply to the fantastic mutations seen within the Shimmer: 'The Shimmer is a prism, but it refracts everything. Not just light and radio waves. Animal DNA. Plant DNA. All DNA.'

We're venturing further into science fiction than accepted science here - and it's worth clarifying that Josie's explanation is a hypothesis that remains unproven within the diegesis--but the notion of refracted matter is far from fiction. At the core of quantum mechanics is wave--particle duality: simply put, every piece of matter is at once a particle and a wave. By definition, waves are subject to refraction, so every piece of matter can, in fact, be refracted. Exploring the associated physics of this is perhaps beyond the scope of a typical high school classroom, but it could be a worthy extension activity for interested pupils.

* How does refraction explain a glass of water reflecting the image behind it?

* Investigate how fibre optics uses refractive properties to transmit information.

A common misconception about Mathematics is that it is dry and deterministic, lacking beauty and artistry. There are few better ways to dispute this viewpoint than the Mandelbrot set: a beautiful, fractal picture of infinite possibilities. This set is, in fact, what the Entity's appearance was modelled after per Rutherford, 'The Mandelblob is an animated 3D manifestation of the Mandelbrot set. That's what the alien is when you see it.' (15)

For junior secondary Mathematics students, this represents a prime opportunity to simply show off the wonder of the Mandelbrot set and, perhaps, associated Julia sets. More advanced mathematicians might wish to explore the underlying mathematics of the Mandelbrot set: how it is generated through iterative series on the complex plane, and even its unexpected ties to chaos mathematics.

You would expect your students to be familiar with the term 'annihilation' as a synonym for 'destruction'. But, as part of the right Physics topic, you could hook into the scientific definition of the term: the collision of a particle and its antiparticle. What are antiparticles? Ah, well, that's a whole 'nother discussion.

If you're really feeling like a deep dive into the foundations of science, Annihilation provides an opportunity to examine the core of scientific discovery. The Hollywood Reporter's Ciara Wardlow argues that Annihilation 'presents one of the best meditations I have ever seen on the metaphysics of scientific inquiry--about the fundamental nature of science that, ironically, cannot in itself be investigated through the scientific method'. Examining what Wardlow is talking about--that 'at the heart of good science is a vein of self-destruction', that our perception of science is torn between 'fascination and repulsion' (16)--necessitates the kind of deep consideration of science that's simultaneously challenging and intensely rewarding.

(1) David Sims, 'The Problem with Annihilation's Messy Release', The Atlantic, 31 January 2018, <https://www.theatlantic.com/entertamment/archive/2018/01/annihilation-paramount-netflix/551810/>, accessed 27 June 2018.

(2) 'Netflix Hits New High in Australia--7.6 Million', media release, Roy Morgan, 28 September 2017, <http://www.roymorgan.com/findings/7343-netflix-subscriptions-june-2017-201709270713>, accessed 27 June 2018.

(3) Jordan Raup, 'Go Behind-the-scenes of Alex Garland's Stalker-inspired Sci-fi Drama Annihilation, The Film Stage, 7 July 2016, <https://thefilmstage.com/news/go-behind-the-scenes-of-alex-garlands-stalker-inspired-sci-fi-drama-annihilation/>, accessed 29 June 2018.

(4) Gav Murphy, 'Alex Garland's 4 Biggest Sci-fi Influences', IGN, 13 December 2017, <http://au.ign.com/articles/2017/12/13/alex-garlands-4-biggest-sci-fi-influences>, accessed 29 June 2018.

(5) Peter Debruge, 'Film Review: Annihilation', Variety, 21 February 2018, <https://variety.com/2018/f1lm/reviews/annihilation-review-natalie-portman-1202706321/>, accessed 29 June 2018.

(6) Dialogue from the film, as spoken by Dr Ventress.

(7) A real 'blink-and-you'll-miss-it' moment. It wasn't until my third time through the film that I realised the second elk wasn't simply behind the first.

(8) There are more than a few ways to interpret the film's ending, which is clearly intended to deliver more questions than answers. Whatever the Shimmer 'wants', it's not necessarily malicious. As Lena puts it in her debrief, 'It wasn't destroying. It was changing everything. It was making something new.'