Information

Understanding Illumina Adapters

Understanding Illumina Adapters


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want to know which sequences to cleave. Illumina TruSeq adapters were used. I have tried following Tuft's explanation and make sense of Illumina's video, but I am left with several unresolved questions.

The TruSeq Universal adapter, seems to be what binds to the flow cell and is

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

The TruSeq Adapter Index N is

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

My impression of how the cDNA fragment attached to the adapters is :

(flow cell) || || || (Index Adapter) (Universal Adapter) || 3' 5' 3' 5' || GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA || |||||||||||||| |||||||||||||| <----- Must get denatured! || 5' AATGATCGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--(5' MY DNA FRAGMENT 3')--AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC‐NNNNNN‐ATCTCGTATGCCGTCTTCTGCTTG ||-------------TTACTAGCCGCTGGTGGCT 3' 5' 3' || || ^(Flow cell oligo) ^(Universal Adapter) ^(Index Adapter) || || TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTG || || ^(Read 1 Primer) ^(Read 2 Primer) || || || TAGAGCATACGGCAGAAGACGAAC----------|| || || ^(Flow cell oligo) ||

Here are my questions :

  1. Is this image correct in the single stranded case?

  2. Do I have the correct primer binding site (used for the actual sequencing)?

  3. Do I have the correct oligo for paired end reads, i.e.TAGAGCATACGGCAGAAGACGAAC---------?

  4. Do I have the correct primer (and it's site) for the index read?

Per Illumina, I guess I need to include this : "Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited."


Illumina Dye Sequencing

The Illumina sequencing platform (formerly known as Solexa) is based on the ‘cyclic reversible termination’ method described in Bentley et al. (2008) . DNA libraries prepared by random fragmentation and linked to adaptors are immobilised on a solid surface called a ‘flowcell’. Flowcells are made up of eight channels, or lanes, which are densely covered with a ‘lawn’ of covalently bound primers complementary to the 5′ and 3′-adapters. Each lane can be loaded with a separate library, either made up from a single sample, or more commonly for bacteria, multiplexed libraries containing up to 96 index-tagged libraries. DNA fragments ligate to the primers on the flow cell, where they are amplified in situ by the process of solid-phase PCR, also known as bridge amplification, which creates identical copies of each single template molecule in close proximity (clusters). This process can produce up to 10 million single-molecule-based clusters in each channel of the flowcell ( Mardis, 2008 Shendure & Ji, 2008 ), all of which are then sequenced simultaneously.

During each sequencing cycle, a single labelled deoxynucleoside triphosphate (dNTP) is added to the nucleic acid chain. The nucleotide also serves as a terminator for polymerization, so after each round of dNTP incorporation, the fluorescent dye is imaged to identify the base and then cleaved along with the termination modification to allow incorporation of the next nucleotide ( Bentley et al., 2008 ). Since all four reversible terminator-bound dNTPs (A, C, T, G) are present as single, separate molecules, natural competition decreases the chances of one nucleotide being incorporated more than the others. Base calls are made directly from signal intensity measurements during each cycle. After each cycle, the labels are removed and this allows the next level of incorporation ( Turcatti, Romieu, Fedurco, & Tairi, 2008 ). Illumina sequencing has become the most commercially successful platform ( Metzker, 2010 Shendure et al., 2011 ), producing reads of up to 125 bp on the Hiseq machines using the SBS v4 chemistry, or 300 bp on the Miseq, depending on the number of cycles. The substitution error rate is typically about 1% or lower, with few false indels.

Multiplexing of 96 samples per lane or 768 samples per flow cell has led to increased throughput for bacterial sequences. Library preparation methods can be modified to perform paired-end sequencing, i.e., the generation of sequence reads from both ends of the template DNA fragments using two sets of sequencing primers ( Roach, Boysen, Wang, & Hood, 1995 ). The Illumina Hiseq 2500 generates up to 1000 Gb of bases per run, with a maximum read number of 4000 M and maximum read length of 2 × 125 bp. The Miseq, a lower throughput, faster turnaround instrument targeted for smaller laboratories and clinical diagnostics was also released in 2011. The Miseq has a maximum output of 15 Gb, read number of 25 M and read length of up to 2 × 300 bp. In 2014, Illumina released the Nextseq 500, which is a desktop sequencer with the capabilities of a Hiseq or Miseq. The Nextseq 500 is currently capable of delivering up to 120 Gb in total output, 400 M read number and 2 × 150 bp reads ( http://www.illumina.com/systems.ilmn ).


DNA Sequencing

Illumina next-generation sequencing (NGS) technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid, accurate sequencing. The process simultaneously identifies DNA bases while incorporating them into a nucleic acid chain. Each base emits a unique fluorescent signal as it is added to the growing strand, which is used to determine the order of the DNA sequence.

NGS technology can be used to sequence the DNA from any organism, providing valuable information in response to almost any biological question. A highly scalable technology, DNA sequencing can be applied to small, targeted regions or the entire genome through a variety of methods, enabling researchers to investigate and better understand health and disease.

One Decade of Sequencing

Explore the breakthroughs, advancements, and progress.

Benefits of DNA Sequencing With NGS

  • Sequences large stretches of DNA in a massively parallel fashion, offering advantages in throughput and scale compared to capillary electrophoresis–based Sanger sequencing
  • Provides high resolution to obtain a base-by-base view of a gene, exome, or genome
  • Delivers quantitative measurements based on signal intensity
  • Detects virtually all types of genomic DNA alterations, including single nucleotide variants, insertions and deletions, copy number changes, and chromosomal aberrations
  • Offers high throughput and flexibility to scale studies and sequence multiple samples simultaneously
Benchtop DNA Sequencers

Compare the speed and throughput of Illumina DNA sequencing systems to find the best option for your lab.

Common DNA Sequencing Methods

Whole-Genome Sequencing

Whole-genome sequencing is the most comprehensive method for analyzing the genome. Rapidly dropping sequencing costs and the ability to obtain valuable information about the entire genetic code make this method a powerful research tool.

Targeted Resequencing

With targeted resequencing, a subset of genes or regions of the genome are isolated and sequenced, allowing researchers to focus time, expenses, and analysis on specific areas of interest.

ChIP Sequencing

By combining chromatin immunoprecipitation (ChIP) assays and sequencing, ChIP sequencing (ChIP-Seq) is a powerful method to identify genome-wide DNA binding sites for transcription factors and other proteins.

Library Prep for DNA Sequencing

Our versatile library prep portfolio allows you to examine small, targeted regions or the entire genome. We've innovated in PCR-free and on-bead fragmentation technology, offering time savings, flexibility, and increased sequencing data performance.

DNA Sequencing Methods Review

This collection of peer-reviewed publications contains pros and cons, schematic protocol diagrams, and related references for various DNA sequencing methods.

Related Solutions

Cancer DNA Sequencing

NGS-based sequencing methods allow cancer researchers to detect rare somatic variants, perform tumor-normal comparisons, and analyze circulating DNA fragments. Learn more about cancer sequencing.

Genotyping Solutions

Sequencing- and array-based genotyping technologies can provide insight into the functional consequences of genetic variation. Learn more about genotyping.

Cell-Free DNA Technology

Cell-free DNA (cfDNA) are short fragments of DNA released into the bloodstream. cfDNA from a maternal blood sample can be used to screen for common chromosomal conditions in the fetus. Learn more about cell-free DNA technology.

Microbial Sequencing

Analysis of microbial species using DNA sequencing can inform environmental metagenomics studies, infectious disease surveillance, molecular epidemiology, and more. Learn more about microbial sequencing methods.

Interested in receiving newsletters, case studies, and information on genomic analysis techniques? Enter your email address.

Additional Resources

NGS Technology

NGS has become an everyday research tool used to address today’s complex biological questions.

Gene Panel and Array Finder

Identify sequencing panels or microarrays that target your genes of interest.

DNA Sequencing Data Analysis

Find intuitive analysis tools that transform raw DNA sequencing data into meaningful results.

Sequencing Troubleshooting Tips

These short videos provide expert tips for issues such as overclustering, inconsistent quantitation, and sequencing through the insert.

Methods Guide

All the information you need, from BeadChips to library preparation to sequencer selection and analysis. Select the best tools for your lab.

Find the Right Kit

Determine the best library prep kit or array for your needs based on your starting material and method of interest.

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.

For Research Use Only. Not for use in diagnostic procedures (except as specifically noted).


Understanding Illumina Adapters - Biology

Illumina FASTQ file generation pipelines include an adapter trimming option for the removal of adapter sequences from the 3’ ends of reads. Adapter sequences should be removed from reads because they interfere with downstream analyses, such as alignment of reads to a reference. The adapters contain the sequencing primer binding sites, the index sequences, and the sites that allow library fragments to attach to the flow cell lawn. Libraries prepared with Illumina library prep kits require adapter trimming only on the 3’ ends of reads, because adapter sequences are not found on the 5’ ends.

Note: Libraries prepared with the Nextera™ Mate Pair library prep kit are an exception, and guidelines for trimming adapters from these libraries can be found in the Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms technical note.

To understand why adapter sequences are found only on the 3’ ends of the reads, it helps first to understand where the sequencing primers anneal to the library template on a flow cell. The diagrams below show the sites of primer annealing at each stage of sequencing run: Read 1, Index 1, Index 2 and Read 2.

Figure 1. MiSeq™, HiSeq™ 1000/1500/2000/2500 and NovaSeq™ 6000 v1.0 reagents paired-end flow cell

Figure 2. iSeq™ 100, MiniSeq™, NextSeq™ 500/550, NextSeq 1000/2000, HiSeq 3000/4000 paired-end flow cell, and NovaSeq 6000 v1.5 reagents

As shown in Figures 1 and 2, in both Read 1 and Read 2, the sequencing primer anneals to the adapter, immediately upstream of the DNA insert (in gray). Because the sequencing starts at the first base of the DNA insert in Reads 1 and 2, the adapter is not sequenced at the start of the read. However, if the sequencing extends beyond the length of the DNA insert, and into the adapter on the opposite end of the library fragment, that adapter sequence will be found on the 3’ end of the read. Therefore, reads require adapter trimming only on their 3’ ends.


Striking back

Illumina seems to be shifting gears in the face of mounting competition. To address the price point concerns, Illumina invested in new cost-lowering innovations and is shipping a new line of sequencers targeted at $600 per genome with a roadmap to achieve $100 per genome. The roadmap also calls for increased investment in artificial intelligence (AI) and support for leading edge "multi-omics," which use advanced sequencing to create a more comprehensive understanding of the biology underlying human health and diseases.

The revitalized approach seems to be paying off. In Illumina's Q1 conference call, CEO Francis deSouza reported orders reached an all-time high, with the company also making progress in penetrating new markets and receiving reimbursement for genomic treatments. For fiscal 2021, Illumina expects year-over-year revenue growth in the range of 25% to 28%, with GAAP earnings per diluted share of $4.72 to $4.97 and non-GAAP earnings per diluted share of $5.80 to $6.05.


DNA Sequencing

Illumina next-generation sequencing (NGS) technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid, accurate sequencing. The process simultaneously identifies DNA bases while incorporating them into a nucleic acid chain. Each base emits a unique fluorescent signal as it is added to the growing strand, which is used to determine the order of the DNA sequence.

NGS technology can be used to sequence the DNA from any organism, providing valuable information in response to almost any biological question. A highly scalable technology, DNA sequencing can be applied to small, targeted regions or the entire genome through a variety of methods, enabling researchers to investigate and better understand health and disease.

One Decade of Sequencing

Explore the breakthroughs, advancements, and progress.

Benefits of DNA Sequencing With NGS

  • Sequences large stretches of DNA in a massively parallel fashion, offering advantages in throughput and scale compared to capillary electrophoresis–based Sanger sequencing
  • Provides high resolution to obtain a base-by-base view of a gene, exome, or genome
  • Delivers quantitative measurements based on signal intensity
  • Detects virtually all types of genomic DNA alterations, including single nucleotide variants, insertions and deletions, copy number changes, and chromosomal aberrations
  • Offers high throughput and flexibility to scale studies and sequence multiple samples simultaneously
Benchtop DNA Sequencers

Compare the speed and throughput of Illumina DNA sequencing systems to find the best option for your lab.

Common DNA Sequencing Methods

Whole-Genome Sequencing

Whole-genome sequencing is the most comprehensive method for analyzing the genome. Rapidly dropping sequencing costs and the ability to obtain valuable information about the entire genetic code make this method a powerful research tool.

Targeted Resequencing

With targeted resequencing, a subset of genes or regions of the genome are isolated and sequenced, allowing researchers to focus time, expenses, and analysis on specific areas of interest.

ChIP Sequencing

By combining chromatin immunoprecipitation (ChIP) assays and sequencing, ChIP sequencing (ChIP-Seq) is a powerful method to identify genome-wide DNA binding sites for transcription factors and other proteins.

Library Prep for DNA Sequencing

Our versatile library prep portfolio allows you to examine small, targeted regions or the entire genome. We've innovated in PCR-free and on-bead fragmentation technology, offering time savings, flexibility, and increased sequencing data performance.

DNA Sequencing Methods Review

This collection of peer-reviewed publications contains pros and cons, schematic protocol diagrams, and related references for various DNA sequencing methods.

Related Solutions

Cancer DNA Sequencing

NGS-based sequencing methods allow cancer researchers to detect rare somatic variants, perform tumor-normal comparisons, and analyze circulating DNA fragments. Learn more about cancer sequencing.

Genotyping Solutions

Sequencing- and array-based genotyping technologies can provide insight into the functional consequences of genetic variation. Learn more about genotyping.

Causal Variant Discovery

High-throughput DNA sequencing technologies allow researchers to rapidly screen large sample numbers to find causal variants associated with complex diseases. Learn more about causal variant discovery.

Microbial Sequencing

Analysis of microbial species using DNA sequencing can inform environmental metagenomics studies, infectious disease surveillance, molecular epidemiology, and more. Learn more about microbial sequencing methods.

Interested in receiving newsletters, case studies, and information on genomic analysis techniques? Enter your email address.

Additional Resources

NGS Technology

NGS has become an everyday research tool used to address today’s complex biological questions.

DNA Sequencing Data Analysis

Find intuitive analysis tools that transform raw DNA sequencing data into meaningful results.

Sequencing Troubleshooting Tips

These short videos provide expert tips for issues such as overclustering, inconsistent quantitation, and sequencing through the insert.

Make an Impact with Multiple Methods

Visit our content hub to discover how combining DNA sequencing with other genomic methods can lead to breakthroughs.

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.


Understanding Illumina Adapters - Biology

Illumina sequencing technology uses cluster generation and sequencing by synthesis (SBS) chemistry to sequence millions or billions of clusters on a flow cell, depending on the sequencing platform. During SBS chemistry, for each cluster, base calls are made and stored for every cycle of sequencing by the Real-Time Analysis (RTA) software on the instrument. RTA stores the base call data in the form of individual base call (or BCL) files. When sequencing completes, the base calls in the BCL files must be converted into sequence data. This process is called BCL to FASTQ conversion.

A FASTQ file is a text file that contains the sequence data from the clusters that pass filter on a flow cell (for more information on clusters passing filter, see the “additional information” section of this bulletin). If samples were multiplexed, the first step in FASTQ file generation is demultiplexing. Demultiplexing assigns clusters to a sample, based on the cluster’s index sequence(s). After demultiplexing, the assembled sequences are written to FASTQ files per sample. If samples were not multiplexed, the demultiplexing step does not occur, and, for each flow cell lane, all clusters are assigned to a single sample.

For a single-read run, one Read 1 (R1) FASTQ file is created for each sample per flow cell lane. For a paired-end run, one R1 and one Read 2 (R2) FASTQ file is created for each sample for each lane. FASTQ files are compressed and created with the extension *.fastq.gz.

What does a FASTQ file look like?

For each cluster that passes filter, a single sequence is written to the corresponding sample’s R1 FASTQ file, and, for a paired-end run, a single sequence is also written to the sample’s R2 FASTQ file. Each entry in a FASTQ files consists of 4 lines:

  1. A sequence identifier with information about the sequencing run and the cluster. The exact contents of this line vary by based on the BCL to FASTQ conversion software used.
  2. The sequence (the base calls A, C, T, G and N).
  3. A separator, which is simply a plus (+) sign.
  4. The base call quality scores. These are Phred +33 encoded, using ASCII characters to represent the numerical quality scores.

Here is an example of a single entry in a R1 FASTQ file:

More detailed information on the FASTQ sequence file format can be found here.

How to view a FASTQ file

FASTQ files can contain up to millions of entries and can be several megabytes or gigabytes in size, which often makes them too large to open in a normal text editor. Generally, it is not necessary to view FASTQ files, because they are intermediate output files used as input for tools that perform downstream analysis, such as alignment to a reference or de novo assembly.

If you need to view a FASTQ file for troubleshooting purposes or out of curiosity, you will need either a text editor that can handle very large files, or access to a Unix or Linux system where large files can be viewed via the command line.

How to generate FASTQ files

FASTQ file generation is the first step for all analysis workflows used by MiSeq Reporter on the MiSeq and Local Run Manager on the MiniSeq. When analysis completes, the FASTQ files are located in <run folder>DataIntensitiesBaseCalls on the MiSeq and <output folder>Alignment_#<subfolder>Fastq on the MiniSeq.

For all runs uploaded to BaseSpace Sequence Hub, FASTQ file generation automatically occurs after the run is completely uploaded, and the FASTQ files are used as input for the various analysis apps on BaseSpace Sequence Hub. On BaseSpace Sequence Hub, you can find your FASTQ files in the project(s) associated with your run.

The bcl2fastq conversion software can be used to generate FASTQ files from data generated on all current Illumina sequencing systems.

For information on the different settings that can be applied during FASTQ file generation, see the software user guides below.


Understanding Illumina Adapters - Biology

Illumina Enrichment kits (DNA and RNA based) help to isolate and enrich specific regions of interest in a genome or transcriptome for sequencing. For example, Illumina DNA Prep with Enrichment (formerly known as Nextera Flex for Enrichment) with the TruSight Cancer Panel targets 94 genes and 284 SNPs that are associated with various cancers.

This bulletin describes the principles of an enrichment reaction, and the commonly used terminology when describing Illumina enrichment kits.

With enrichment kits, ‘Reaction’ (abbreviated “rxn”) refers to the number of enrichment reactions that are provided with the kit. ‘Plexity’ (abbreviated “plex”) refers to the number of pre-enriched libraries that are pooled together in an enrichment reaction. For example, an 8-rxn x 12-plex kit has enough reagents to perform eight enrichments. In each enrichment reaction, 12 libraries can be pooled. Therefore, the total number of samples that can be prepared with this kit is 96 samples. The following figure illustrates how three libraries are pooled in one enrichment reaction.

In this illustration, the three pre-enriched libraries are prepared then pooled together at equal amounts (by mass) for hybridization with target-specific enrichment probes (3-plex pooling). These probe-bound fragments are then captured with streptavidin beads. Any unbound fragments are washed away, and the bound fragments, enriched for the sequences of interest, will be eluted off the streptavidin beads and sequenced.

DNA Enrichment kits – enzymatic fragmentation of the DNA

Illumina DNA Prep with Enrichment (formely known as Nextera Flex for Enrichment) is based on the enzymatic fragmentation of the DNA with a transposome enzyme. The following probe panels are used with Illumina DNA Prep with Enrichment:


NGS Library Construction

As sequencing output increases and experimental scales are growing, generating libraries for sequencing is often the rate-limiting step. We are happy to discuss the options and protocols suitable for your specific research projects. We can prepare standard as well as specialized libraries of various types, including genomic DNA with different size inserts, RNA-seq with Ribo-depletion or strand specific options, exome capture, ChIP-seq, and microRNA-seq. We have streamlined and automated library preparation and can now generate up to 96 different barcoded libraries using the IntegenX Apollo 324 robot and Caliper Sciclone G3 for consistent quality and rapid turnaround. We can also provide training and access to the robots if you wish to use the instruments yourself for large-scale projects.

Starting material for Illumina library construction is usually double stranded (ds) DNA from any source: genomic DNA, BACs, PCR amplicons, ChIP samples, any type of RNA turned into ds cDNA (mRNA, normalized total RNA, smRNAs), etc. Pretty much anything you can think of that ends up as, or can be turned into, dsDNA. This dsDNA is then fragmented (if it is not already, as in ChIP). The average fragment length should not exceed 600 bp (HiSeq 2500, MiSeq) or 350 bp (HiSeq 3000). Then the ends are repaired and ‘A’ tailed, adapters are ligated on, size selection is carried out, then PCR performed to generate the final library ready for sequencing. Different library types might vary in the details (such as PCR-free library) but this is the basic workflow. An excellent forum for sequence related questions of all kinds on all platforms is the Seqanswers.com forum.

DNA/RNA sample quantification and purity
The input DNA and RNA quantities specified below and in this table apply if the samples are quantified by a fluorometric method (e.g. Qubit, PicoGreen, RiboGreen). Fluorometry provides advantages in precision and specificity (e.g. DNA dyes will not bind to/measure RNA). If a spectrophotometer (e.g. Nanodrop) is used, we suggest submitting twice the requested amount of sample since this type of measurement is often unreliable. In any case, sample amounts higher than the minimum requirements will improve the library complexity. Spectrophotometer readings are very useful to assess the purity of samples. For DNA samples the ​260/280 ratio should be between 1.8 to 2.0 and the 260/230 ratio should be higher than 2.0. For RNA samples the 260/280 ratio should be between 1.8 and 2.1 and 260/230 ratio should be higher than 1.5. Values outside of these ranges indicate contamination. The Real-time PCR Core can carry out DNA as well as RNA extractions.

Sequencing Library Prep Services: Sample Requirements

Please also see the Comprehensive Requirements Table

DNA Based Libraries

Performance specifications of libraries we produce depends on the source material. Genomic DNA, double strand cDNA libraries, BACs, or other material available in microgram quantities will generate quality libraries nearly every time.

Guidelines for Submission of Library-Worthy DNA
Provide 2 ug or more of high quality DNA (concentration > 50 ng/ul, OD 260/280 close to 1.8 260/230 ratio >2.0) in EB or TE buffer (EB buffer preferred), or molecular biology grade water. Library construction can also be attempted from less input material, with caveats. If the total input material for library prep is below 100 ng special library prep protocols need to used. For PCR-free libraries sample amounts of 5 ug DNA are recommended working with less is possible.

ChIP Libraries
We offer library construction from chromatin immunoprecipitated material. For these more complex experiments, discussions with Core personnel regarding suitability of starting material and construction strategy are recommended. No guarantees are offered with this library service, other than we’ll do our best! For general background, the ChIP-Seq Data Technical Note and ChIP-Seq DataSheet from Illumina may be of interest.

Mate Pair Libraries
The sequencing of Mate Pair libraries generates long-insert paired-end reads. The libraries are generated by self-ligation of long DNA fragments and labeling of the junction sites to generate chimeric library molecules that bring together sequences that were originally 2kb to 12 kb apart. We are using the Illumina Nextera Mate Pair kit which employs a transposase enzyme to fragment as well as end-tag the DNA in a single step. The tags are biotinylated and thus allow for the selection of junction sites containing fragments. In contrast to older mate pair library protocols, the Nextera kit is very reliable with the exception of the sizing of the initial fragments. As with all other long DNA fragment analyses, the DNA quality matters. Please email us an gel-image before submitting the DNA samples. The samples should run as a band of 20kb size or longer on agarose gels.
The Nextera kit offers two protocols: the “gel-free” version (1 ug input), which is mostly of interest when only little input DNA is available. The sizes of the mates-pair fragments from this protocol usually range from 1.5 kb to 10kb. Surprisingly the SSPACE scaffolder can still work with these data.
The “gel-plus” version requires a minimum of 4 ug input DNA (and 4 times the reagents) and uses gel extractions to size select fragments within a range of +- 700 bp for shorter mates and within +- 2kb for longer mates of up to 10 to 12 kb. Due to the uncertainties of the fragmentation please submit at least twice the amount of sample.
In theory the fragment sizes resulting from the tagmentation are only dependent on the input DNA amount. In praxis the fragment lengths vary considerably between different DNA samples of similar amounts. This variability between samples can be observed even after precise DNA quantification by fluorometry. The reactions are tune-able for aliquots of the same sample, though. Especially if very specific size ranges are desired it is often necessary to repeat the tagmentation reaction with adjusted DNA amounts. We might then combine similar sized gel extraction fractions from two tagmentation reactions to generate libraries of high complexity for the desired size ranges. Please let us know how important specific insert size ranges are for your project.
Because of the difficulties to predict the fragment size ranges, we are quoting mate pair recharge rates including two tagmentation reactions. If we can generate the desired library with a single tagmentation, we charge the lower rate of the one-tagmentation library prep.

Target Enrichment
Numerous companies provide services and platforms that generate whole exome or target amplification. We offer the Fluidigm Access Array, which employs nanofluidics for cost-effective target selection to generate barcoded amplicon libraries that are ready for Illumina sequencing. Sequence Capture Libraries are those in which particular genomic regions are enriched after indexed library generation and sequencing. This strategy allows focused, very deep sequencing and can be implemented for a number of applications. Several companies offer platforms that can generate such material, including Illumina, RainDance, Agilent, NimbleGen, and Fluidigm. Technical information on the Agilent, Nimblegen, RainDance, and Qiagen (which uses a PCR based, not hybridization capture strategy, for enrichment) systems are available but not guaranteed to be up to date. Think of them as a starting point for further investigation (we have the contact info for company reps if needed) and solely informational (no implied endorsement etc.).

RNA-Seq Libraries

Something of a misnomer because all the libraries end up as DNA, but this refers to the starting material. We offer RNA-seq library preparation, with a number of options such as ribo-depletion, poly-A enrichment, strand-specific libraries as described below as well as micro-RNA (miRNA) and small RNA library preps.

Guidelines for Submission of Library-Worthy RNA
Provide at least 1 ug (2 – 5 ug preferred) of total RNA at a concentration of at least 50 ng/ul (1 ug for Poly-A enrichment 2 ug for ribo-depletion libraries using less starting material is possible, but we can’t guarantee results). Please make sure that your RNA isolation protocol employs a DNAse digestion step or other means to remove DNA from the sample. On an agarose gel, DNA contamination will be visible as a smear of band of fragments considerably larger than the RNA (>10 kb). To verify the purity of the RNA samples the 260/280 ratio should be between 1.8 and 2.1 and 260/230 ratio should be higher than 1.5. Poly-A enrichment, ribo-depletion and strand specific library prep are among the commonly requested types of service (more technical details on this appear below). We suggest following the recommendations from Illumina – for human samples use total RNA with a bioanalyzer RIN score of 8 or better, for plant material RIN numbers can be lower and tissue-specific (this is mainly a function of the chloroplast content). Libraries for slightly degraded RNA samples should be prepared using ribo-depletion protocols. If possible please avoid RNA extraction protocols involving Trizol or related phenol containing reagents (silica column based kits are less likely to retain contaminants). If using Trizol, protocols that contain a column based cleanup (e.g. Direct-zol, TRIzolPlus) have to be used. Please note that an additional column cleanup is mandatory for RNA samples isolated from PAXgene tubes or with PAXgene kits. RNA samples should be eluted in molecular biology grade water, always stored in a -80 degree freezer and shipped on dry ice. All RNA samples require a Bioanalyzer sample QC (or equivalent). Such QC traces can be submitted by the customers or we can run the QC for a fee instead.

Poly-A Enrichment
Total RNA samples can contain up to 90% ribosomal RNA sequences, which are uninformative for transcriptome or gene expression studies, while mRNAs typically make up only 1 to 2% of total RNA. Thus the enrichment of samples for mRNAs is highly desirable. Poly-A enrichment is the most commonly used method to enrich mRNA sequences from eukaryotic total RNA samples mRNAs are selected by hybridization to poly-T oligos bound to magnetic beads.

Ribosomal RNA Depletion
There are multiple commercially available kits to remove ribosomal RNA from your total RNA. The main reason for rRNA depletion is to reduce highly abundant ribosomal RNA especially when transcripts do not carry polyA (bacterial RNA), and also when you desire to retain all long non-coding RNA (lncRNA) and polyA classes of RNA in your sample. Commercial kits containing rRNA removal solution are available for different types of total RNA they include human, mouse, rat, bacteria (gram positive or negative), plant leaf, plant seed and root, and yeast. Ribo depletion protocols can further enable the analysis of slightly degraded RNA samples. We ask for at least 2 ug of total RNA for the preparation ribo-depleted libraries. As always libraries can be generated from less material, but the complexity can suffer.

Micro RNA and Small RNA Libraries
We offer library construction for micro and small RNAs from total RNA using the Illumina protocol and reagents. We size select the libraries with high precision using the Blue Pippin system. The minimum recommended amount of total RNA required for these preps is 1 microgram (recommendations for humans samples). Since the total RNA composition can vary widely between tissues and organisms, please aim to provide at least 2 ug of total RNA. Please also take care that you RNA isolation method actually retains micro and small RNAs. The total RNA samples should be submitted in molecular biology grade water at a concentration of 200 ng/ul. High quality RNA is recommended (the total RNA samples should have RIN scores of 8 or higher according to a Bioanalyzer QC) and should have been DNAse treated before sample submission.

Strand-Specific RNA Libraries
By default we generate strand-specific RNA-seq libraries in the Core. Please let us know if you would prefer the traditional non-stranded library prep instead. Strand-specific (also known as stranded or directional) RNA-seq libraries substantially enhance the value of an RNA-seq experiment. They add information on the originating strand and thus can precisely delineate the boundaries of transcripts in regions with genes on opposite strands, and can determine the transcribed strand of non-coding RNAs. During the cDNA synthesis dUTP is incorporated in the second-stand synthesis. After adapter ligation the dUTP-containing strand is selectively degraded, to preserve strand information for RNA-seq. The forward read of the resulting sequencing data thus represents the “anti-sense strand” and the reverse read the “sense strand” of the genes (for Trinity transcriptome assemblies the “–RF” orientation flag should be used).

Other Library Considerations

PCR-Free Libraries
Libraries generated without amplification will reduce library prep biases. Thus, they can improve the sequencing coverage of genomic areas such as GC-rich regions, promoters, and repeat regions, and enhancing the detection of sequence variants. Please note that PCR-free libraries are more difficult to QC and quantify (please see the bottom of the page) and that the yields tend to be lower for these libraries compared to amplified libraries (10-15%). PCR-free library prep will also require a greater amount of starting material (>5 fold).

Indexed Libraries
Indexing, also called barcoding, allows for the sequencing of multiple libraries in a single lane, i.e., multiplexing. By default all libraries generated by us have a barcode. Multiplexing is required when the typical lane output of 15-25 million reads from the MiSeq, 120-180 million reads from the HiSeq 2500, or 260-310 million reads from the HiSeq 3000 is greater than required for a single library (e.g., in sequencing BACs, PCR generated fragments, small microbial genomes, transcriptomes, exome, ChIP, and small RNA applications). Multiplexing is also the best way to minimize potential lane-to-lane sequencing variation, as all of your samples are subject to the same sequencing conditions. For example, if you require two sequencing lanes for six samples we recommend 6-plexing and sequencing over two lanes, instead of 3-plexing per lane. The principle is that short nucleotide “barcodes” are appended to each library using specific adapters containing those sequences. Libraries containing different indexed adapters are then constructed, quantified, pooled in equimolar amounts, and sequenced. Deconvoluting the barcodes informatically allows multiple libraries to be sequenced in a single lane at a potential cost and time saving. To date, two methods have been exploited for this: using the commercially available indexing kits (Illumina TruSeq, Nextera, or Bioo Scientific) or synthesizing your own adapter oligos with your own barcodes. With the Illumina TruSeq v2 Library Prep Kits A and B you can use up to 24 different barcodes per kit to multiplex up to 48 libraries. Bioo Scientific offers Illumina-compatible barcodes (NEXTflex) with up to 96 barcodes. The Nextera kit (Epicentre/Illumina) uses dual indexing and transposon mediated fragmentation (‘tagmentation’) followed by PCR amplification to integrate barcoded adapters (so a PCR-free library is not an option using the Nextera kit). The dual indexing/adapter tagging strategy (with up to 12 indices available for adapter 1 and up to eight indices for adapter 2) permits up to 96 unique dual index combinations.

Homemade indexing has been used successfully by multiple users. Please avoid the “in-line” barcoding strategy and use Truseq or Nextera-style adapter designs instead (i.e. the barcodes are read in a separate read and do not interfere with cluster registration). It is important to ensure that the base composition of the indices are balanced to optimize the ability of the image analysis software to distinguish signals.

Libraries: Make Your Own

Library construction involves DNA fragmentation (if necessary, depending on the nature of the initial sample), enzymatic treatment of the DNA to repair and A-tail the fragments, ligation of sequencing adapters to these fragments, then subsequent PCR amplification (or skip this for PCR-free libraries), with or without size selection depending on the application. See below for more information on these various aspects of library construction. We also offer Next-Gen Library Prep Training Workshop for comprehensive hands-on training on how to prepare high quality libraries for Illumina sequencing.

Fragmentation
DNA to be made into a sequencing library must first be converted into small fragments. The average insert length should not exceed 600 bp (HiSeq 2500, MiSeq) or 350 bp (HiSeq 3000). There are several methods for doing this, each with attendant pros and cons. Many protocols and centers rely on and recommend a fragmentation device from Covaris, which uses adaptive focused acoustics to break the DNA into appropriately sized fragments. The Covaris E220 can meet the demands of high throughput library production. We primarily use a Covaris E220 and Diagenode Bioruptor NGS (or Bioruptor UCD-200). Access to these instruments is available through the Core, with the usual training and sign up guidelines for Core-available equipment in effect.

Basic DNA and RNA Library Protocols
We use library kits from Illumina, Wafergen, Kapa Biosystems, Bioo Scientific, CloneTech, and NuGen as a source of the fragment repair, tailing, and amplification enzymes. There are a number of other next-gen related products currently being used in the research community. For mRNA-seq libraries we are currently using the stranded Illumina kit. New products are out there and we encourage you to do research if RNA-seq libraries are of interest. In particular, ribosomal RNA depletion protocols that integrate with Illumina kit, and novel RNA amplification and library production resources from NuGen and CloneTech, have expanded the services we offer and will no doubt continue to do so. In other words, keep checking this site to see how things evolve.

The Illumina Adapter Oligonucleotides
The oligonucleotide sequences of the Illumina adapters are available here . Illumina tends to sell their adapters only in conjunction with library prep kits. Other vendors of fully compatible ready-to-go adapters include Bioo Scientific. Custom synthesis from companies like MWG-Eurofins, Bioneer, and IDT is another valid option. Two things to note – the “top” Indexed adapter (starting with GATC) must be phosphorylated, and the “bottom” Universal adapter can be synthesized with a special linkage between the 3′ terminal T and the preceding C. This phosphorothioate linkage renders the overhanging T (after annealing the top and bottom adapter oligos) more nuclease resistant, diminishing the probability of adapter dimers (more on adapter dimers below).

Libraries: Quality Control (QC)

Library quality is the single most important determinant of the success of your sequencing run, both in terms of the number of reads generated (quantification) and the validity of the sequence obtained (content). Methods for construction and analysis continue to evolve while now somewhat dated a useful early paper by Quail et al. from the Sanger Institute lists a number of improvements over the standard Illumina protocols in library preparation and analysis. If you construct your own libraries you may want to download this paper and a supplementary methods table for the many practical issues covered. We carry out two QC measures on all libraries sequenced in our Core – examination on the Agilent Bioanalyzer, and quantification using the Kapa Biosystems Illumina Library Quantification Kit.

The Bioanalyzer provides a detailed visual examination of the libraries. The “perfect” library electropherogram, pictured here, shows a single peak of the expected molecular weight. Common additional forms include primer dimers (at around 80-85 bases), adapter dimers (around 120 bases), and broader bands of higher MW than the expected peak. Primer dimers, minimized by the use of magnetic beads, are not a problem unless they completely dominate the reaction. Adapter dimers can be a problem because they will sequence much more efficiently. As a result, whatever the proportion of adapter dimers in your library will be seen as an even higher percentage of reads in your final data files. Adapter dimers can be minimized by adjusting the adapter:insert ratio during library construction and exercising care in gel extraction or other size selection steps. The larger MW, typically more hump-shaped forms that are visualized on the Bioanalyzer are probably a result of excess amplification during the final PCR step. While some amount of these are tolerable, if they are too prominent then the library should be re-amplified from the gel extracted material.

We use a qPCR assay for library quantification – the Kapa Biosystems qPCR assay is run on all the libraries we sequence (and is included in the sequencing price). This has allowed us to provide much more consistent cluster values, which translates to more consistent read numbers. For long runs in particular it’s essential to maximize the data recovered given the time and money involved, which is why we recommend this quantification so strongly.

Library Requirements, Submission, and Storage

Submission
We must receive electronic ([email protected]) and print copies (submitted together with samples) of the appropriate submission form. All customer submitted libraries should be accompanied by Bioanalyzer (or similar) traces. If no traces are submitted we will carry out the Bioanalyzer analysis for a fee. Please visit the Sample Submission & Scheduling page to download submission forms and for more detailed instructions. The same form is currently used for both library preparation and library sequencing submissions. Please contact us if you have any questions about the required information it is essential that you fill in all the information to minimize the chance for error on these expensive and time consuming experiments. One thing we need to know is the approximate insert size desired in the absence of specific preferences we recommend about 220 bp for most mRNA and DNA libraries, but insert sizes should be larger for the longer read MiSeq runs. For certain applications, such as de novo assembly, a range of sizes may be desired and we can accommodate that. But again, we strongly recommend verifying the suitability of these values for the experiment you are trying to do.

Sequencing Library Requirements
The standard requirements for library submission are at least 15 ul volume at a concentration of 5 nM (e.g., 2.3 ng/ul given a 700 bp library). More volume and/or higher concentration is welcome. We can work with less library (down to 1 nM), but the quantification becomes less reproducible, the library becomes less stable, and relatively larger amounts of library DNA stick to the sides of the storage tube. Lower sequencing yield is the likely outcome for library concentrations 1 nM or less, and we cannot guarantee the data quantity or quality for such libraries. The best buffer to ​store and submit libraries is 10 mM Tris​/0.01% Tween-20 ph=8.0 or 8.4​, but EB buffer is also acceptable​​. If possible ​please use 0.6 ml or 1.5 ml low-bind tubes. If you do not provide a Bioanalyzer trace (or equivalent) of your library, we will do this for a fee. Please note, the DNA insert size(s) should not exceed 700 bp and most Illumina adapters add about 120 bases to the fragment length as observed on the Bioanalyzer. When submitting your libraries for sequencing, please use our Illumina Sequencing Submission Form (hard copy with samples, and email to [email protected]), provide the Bioanalyzer profile, library prep methods, and index sequences used. We will measure the quantity of your libraries using real-time PCR (included in the sequencing price).

Libraries for HiSeq 3000 sequencing – The latest generation of sequencers has more stringent library requirements and requires higher library concentrations. The average insert size should ideally be 350 bp and the “tail” of longer fragments should not exceed 550 bp. The new clustering chemistry is more sensitive to adapter dimers: a 5% adapter-dimer contamination can result in 60% of the reads coming from these dimers. Thus it is very important that there is no indication of an adapter-dimer peak (around 120 bp) on the Bioanalyzer trace. Our preferred requirements for library submission are for at least 15 ul volume of 5 nM concentration (e.g., 1.6 ng/ul given a 470 bp library). More volume and/or higher concentration is welcome. Lower sequencing yield is the likely outcome for library concentrations 2 nM or less, and we cannot guarantee the data quantity or quality for such libraries.

PCR-free Libraries QC – The quality of these libraries is difficult to assess. The adapters of these libraries are partly single-stranded. Thus they tend to migrate slower than the fully double-stranded amplified libraries on the Bioanalyzer. In most cases the libraries appear to be 70 to 100 nt longer than they actually are – however the bioanalyzer traces can also be off by far larger margins (e.g. 500 bases). To be sure about the actual library fragment lengths we highly recommend to PCR-amplify an aliquot (1 ul) of the libraries with 8 PCR cycles and run both the PCR-free and the amplified sample on the Bioanalyzer. If multiple PCR-free libraries will be pooled, you might consider quantifying the individual libraries by qPCR before pooling.

Custom Sequencing Primers Please note that these are used only for a small minority of sequencing projects. Custom sequencing primers need to be submitted at a concentration of 100 uM and a volume of 20 ul each together with the libraries. Please make sure that the sequencing primer design fits the chosen Illumina platform. Miseq and Hiseq platforms use different annealing temperatures.

Scheduling
Once your library, or library raw material, is ready, you should deliver it as soon as possible to get the next available slot in the queue. Runs occur as we fill up the two (rapid mode) or eight (high-output mode) lanes on a HiSeq flow cell, and the timing on this can vary depending on service type and Core activity. For MiSeq runs the turnaround time is typically five to eight days, while you should allow three to five weeks for HiSeq sequencing in both cases allow an extra one to two weeks for library prep. The HiSeq sequencing scheduling calendar is now available on our website.

Sample/Library Storage Policy
Please let us know if you would like to pick up your samples/libraries after they have been sequenced and we will be happy to accommodate you otherwise, due to space limitations, they will be stored for only six months after sequencing runs have been completed.


Understanding Illumina Adapters - Biology

Sequencing random fragments of DNA is possible via the addition of short nucleotide sequences which allow any DNA fragment to:

  1. Bind to a flow cell for next generation sequencing
  2. Allow for PCR enrichment of adapter ligated DNA fragments only
  3. Allow for indexing or 'barcoding' of samples so multiple DNA libraries can be mixed together into 1 sequencing lane (known as multiplexing)

During library preparation each DNA fragment gets and addional A overhang added to both ends.

The sequencing adapters are the following:

The stars indicate a phosphorothioate bond between the last C and T to prevent cleaving off the last T that is needed for annealing the overhang. The phosphate group on the indexed adapter is required to ligate the adapter to the DNA fragment.

The NNNNNN in the indexed adapter above represents the barcode. Reverse the indexed adapter and note how the last 12 bases are complementary.

Once ligated to a DNA fragment the following arrangement will occur. Left side of the fragment will be:

The right side of the fragment will contain

Both ends before and after the annealed part are "floppy", hanging off.

The PCR Primer 1.0 is identical to the first 44 bases of the TrueSeq Adapter

The PCR Primer 2.0 is the reverse complement of the last 24 bases of the Indexed Adapter

The resulting PCR product will look like this for both strands:

where U stands for the Trueseq Adapter, S stands for DNA sequence that is to be sequenced and I stands for the Trueseq Indexed Adapter. The U will bind to the flowcell.

It is important to remeber that the S sequence could originate from both strands but the sequencing will only process reads that have a the U on the forward strand.

Created by Istvan Albert &bull Last updated on Thursday, December 11, 2014 &bull Site powered by PyBlue


Watch the video: Subtle Grey Blending with Illumina Colour (October 2022).