Information

Do Tumor-Infiltrating T Cells Experience Any Prolonged Effects Due To Hypoxia After They Return To Normoxia?

Do Tumor-Infiltrating T Cells Experience Any Prolonged Effects Due To Hypoxia After They Return To Normoxia?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Adoptive cell transfer (ACT) therapy using tumor-inflitrating lymphocytes (TIL) is at the cutting edge of immuno-oncology treatments involving metastatic melanoma and other indications (1). The idea is that at some point during the growth of a tumor, some T cells attempted to mount an immune response, extravasated and got into the tumor, but they became overwhelmed and exhausted. The therapy itself involves taking these cells out from some excised tumor, reversing their condition and since they're already neo-antigen specific from having attempted an attack on that cancer: Expand them, put them back in the patient, let them hit the tumor much harder than before.

Not only do you need to reverse exhaustion in the TIL, but you also need to have the right population of T cells to get the best response. The factors involved are beyond this question, and so I'll get to the point.

In the tumor environment, the T cells become exhausted and their expression profile changes (2). It makes them more prone to apoptosis and they lose effector functions like GranzymeB production. You can tell how this is problematic. My suspicion is that in the tumor the T cells may become hypoxic, and what we know is that in the oxygen-sensing pathway, hypoxia inducible factors exert their effect. Normally, these should be kept in check by inhibiting proteins if they get produced under normoxia:

And so to my question:

After prolonged exposure to hypoxia, are there any regulatory or transcriptional changes that after prolonged return to normoxia render either of HIF1α or HIF2α active where they would normally be repressed?

Whether I just need a fresh set of eyes or the data just doesn't exist, I haven't necessarily found it obviously. I'd like to know if there's a remnant hypoxia-like regulation framework that remains after O2 gets back to normal that affect pathways like mTORC1/2. Thanks if advance for any insights!


Cardiovascular adaptation to hypoxia and the role of peripheral resistance

Systemic vascular pressure in vertebrates is regulated by a range of factors: one key element of control is peripheral resistance in tissue capillary beds. Many aspects of the relationship between central control of vascular flow and peripheral resistance are unclear. An important example of this is the relationship between hypoxic response in individual tissues, and the effect that response has on systemic cardiovascular adaptation to oxygen deprivation. We show here how hypoxic response via the HIF transcription factors in one large vascular bed, that underlying the skin, influences cardiovascular response to hypoxia in mice. We show that the response of the skin to hypoxia feeds back on a wide range of cardiovascular parameters, including heart rate, arterial pressures, and body temperature. These data represent the first demonstration of a dynamic role for oxygen sensing in a peripheral tissue directly modifying cardiovascular response to the challenge of hypoxia.


DEFINING TUMOUR HYPOXIA

Normoxia and physoxia

Despite the many studies on tumour hypoxia, there is considerable confusion in the use of the terms “normoxia” and “hypoxia”. Oxygenation measurements in normal tissues show that they exhibit distinct normal ranges, which vary between tissues (Table 1). However, “normoxia” is almost universally used to describe the “normal” oxygen levels in tissue culture flasks, i.e. about 20–21% oxygen (160 mmHg). Although this is not exact, as it is dependent on altitude and added CO2, for most situations, 20% is a good approximation. Despite the widespread usage of “normoxia”, this is far from an accurate comparator for peripheral tissue oxygenation. Even in lung alveoli, the oxygen level is reduced to about 14.5% oxygen (110 mmHg) by the presence of water vapour and expired CO2. 13 It drops further in arterial blood and, by the time it reaches peripheral tissues, the median oxygen levels range from 3.4% to 6.8% with an average of about 6.1% (Table 2). 13

Table 1. Approximate levels of oxygen in normal tissues and tumours

aIt is impossible to put exact figures on tissue levels. The values provided are a guide derived from several sources (see also Table 2).

bNormal physiological responses to hypoxia occur above about 15 mmHg (2% oxygen). Normal tissues should not get below this since homeostasis tends to return oxygen levels to physoxia. The exact oxygen level for the upregulation of hypoxia response genes is not known it may vary between different tissue/cell types since normal tissues have different median oxygen levels.

cThe presence of pathological hypoxia indicates that the tissue has not been able to revert to physoxia. In normal tissues, persistence of low oxygen will cause tissue necrosis, which can have significant functional consequences. In tumours, this can also happen. Since the tumour is an abnormal growth, loss of tissue through necrosis has no known functional significance. However, hypoxia-resistant tumour cells will initially become quiescent eventually, there will be selection for hypoxia-tolerant more malignant tumour cells.

Table 2. Summary of reported values of the partial pressure of oxygen (pO2) in human tumours and related normal tissues

n, number of patients ND, not determined.

The data included in the table are primarily a summary from a meta-analysis carried out by Vaupel et al. 5 The number of studies included for each tumour type is indicated by the number in the “tumour type” column. Other data are from single studies, as referenced. The final “average” values for tumour and normal tissue oxygenation are indicative only they are provided to illustrate the disparity between the two values. The range is considerable and reflects the different tissue origin of the tumours despite this, there is very limited overlap with the normal tissue data. (The averages were calculated adjusting for the number of values in each cohort.)

aFold reduction of tumour vs normal tissue is based on all the data presented in the table (except prostate see further notes).

bFold reduction calculated on contemporaneous measurements in the psoas muscle.

cData from a pilot study that included values from the “normal” prostate of two bladder cancer patients.

This clearly highlights the anomaly of the term “normoxia”. Since normal peripheral tissues are exposed to oxygen levels about 75% lower than inspired air, it is proposed that 5% oxygen (38 mmHg) is a more accurate approximation of tissue oxygenation and that this should be recognized as “physoxia” against which other experimental conditions should be compared. Researchers do not accept such an inaccurate value for other parameters such as pH, glucose etc., yet, surprisingly, they ignore the importance of controlling for oxygen, which has been known for many years to be toxic. 34 It should be noted that equilibration of culture media to the oxygen level in a specific gassing mixture can take up to 3 h 35 this can be avoided if the gas mixture is in direct contact with the cell monolayer, which can be achieved if cells are grown in oxygen-permeable culture flasks (www.coylab.com). Since % oxygen is more physiologically meaningful than mmHg, it is proposed that % oxygen is a better unit for reporting oxygen levels as it more adequately illustrates the relatively low, but clearly normal, oxygen levels in many tissues it also better highlights the particularly low levels of oxygen found in tumours. (Note: the SI unit for gas pressure is kpascal fortuitously 100% oxygen is equivalent to 101.3 kpascals, so these units are numerically almost equivalent.)

The lower limit of physoxia is about 3% oxygen (23 mmHg) (Table 1). Homeostasis maintains physiological parameters within tight limits with individual tissues having preferred median oxygen levels (Table 2 see also Carreau et al 13 ). This variation suggests that cells of different origins have different oxygen sensitivities, and normal tissues are also known to have a range of tolerances to reducing oxygen. Brain tissue is particularly sensitive and can only survive about 3 min without adequate oxygenation, whereas other tissues are more tolerant, e.g. kidney and liver (15–20 min), skeletal muscle (60–90 min), vascular smooth muscle (24–72 h) and hair and nails (several days). 36

Physiological hypoxia

“Physiological hypoxia” can then be defined as the oxygen level at which tissues respond to maintain their preferred oxygen level. This can be by physiological means, e.g. vasodilation, increasing blood flow, and/or upregulation of hypoxia response genes. 12 Since physoxia varies for individual tissues, they are likely to have different hypoxic trigger points below which this occurs. In normal tissues, this will presumably be transitory but sufficient to return the tissue to its preferred oxygen level. However, since normal tissues are ordinarily maintained at 3–7% oxygen, physiological hypoxia is likely to be in the range 2–6% oxygen. This suggests that hypoxia response elements may well upregulate at different oxygen levels in different tissues. Currently, it is difficult to envisage how “physiological hypoxia” can be measured since homeostasis should work to reverse it almost immediately, so any manifestation would be transitory. This will be maintained by a number of changes, including increases in perfusion and temporary stabilization of hypoxia inducible factor (HIF), while readjustments are made. 37 When HIF1α and HIF1β expression was measured in cultured HeLa cells from 0% to 20% oxygen, a maximal response was found at 0.5% oxygen with a half maximal expression at 1.5–2% oxygen expression was significantly low above 4% oxygen, 38 confirming that HIF1 is active in the required range to control physiological responses to oxygen deprivation (discussed further below).

Pathological hypoxia

Having identified the approximate range of “physiological hypoxia”, this helps to delineate the oxygen levels which are found in pathology. Indeed it begs the question, why in pathological tissues do the homeostatic mechanisms not respond effectively to reverse the falling oxygen levels? In ischaemic disease, which can be either chronic (e.g. in diabetes, reduced lung function etc.) or acute (e.g. stroke, coronary artery occlusion etc.), re-establishment of homeostasis may not be possible owing to the loss/occlusion/reduced flow of vessels feeding the tissue in question. However, in tumours there is often enhanced angiogenesis yet the oxygen levels (even in untreated tumours) are significantly lower, ranging from 0.3% to 4.2% oxygen (2–32 mmHg), with almost all falling below 2% (Table 2). It is generally recognized that the tumour vasculature is chaotic and is composed of leaky vessels with blind ends, shunts and a tendency to collapse. 39 Clearly, the vasculature fails miserably to maintain the oxygen levels, which are well below the adjacent normal tissues (Table 2), despite evidence in many situations that HIF1 is up-regulated. 40

It is clear, therefore, that tumours are well adapted to grow and expand in this persistently oxygen-depleted tumour micro-environment (TME). In defining “pathological hypoxia”, there are no absolutes however, the reality is that all tumours tend to have median tumour oxygen levels <2% and, within that estimation, individual measurements can vary from about 6% (very rarely) down to zero with a significantly marked skewing towards the lower end of this range frequently, most values are well below 1.3% oxygen (10 mmHg), especially in the more hypoxic tumours. Many examples of this non-gaussian distribution are found in the publications cited in Table 2.

In tumours, it appears that the homeostatic processes are disrupted for two main reasons. Firstly, the vasculature is of very poor quality and cannot adequately and reliably provide oxygen to the growing tumour. Indeed, if putative tumour cells were sensitive to low oxygen they would die as the oxygen levels are insufficient. This leads to the other main reason: clearly, the tumour cells do not die, showing that a sizeable proportion of them are significantly hypoxia tolerant. In part, this may be attributed to their switch to glycolysis for the supply of most of their energy requirements, a feature of tumours that was identified many years ago by Warburg. 41 In addition, exposure to prolonged pathological hypoxia will select for hypoxia-tolerant tumour cells that are stress resistant and more malignant (see below). It is difficult to be precise about the exact level of oxygen at which this occurs however, it is almost certainly <1% oxygen (7.5 mmHg) and may well be significantly lower. It is noteworthy how well tumour cells adapt to significantly low oxygen levels. In one study, hypoxia only caused death of tumour cells when oxygen levels were <0.01% (0.075 mmHg) for more than 24 h. 42 In our studies, a proportion of LNCaP tumour cells survived exposure in vitro to 48 h or longer of 0.1% oxygen. 43 More recently, we have shown that the median oxygen level of bicalutamide-treated LNCaP prostate xenografts remained below 0.1% oxygen for more than 10 days. 44 Overall, survival in this extreme stress will drive selection for malignant phenotypes that are governed by a Darwinian selection process. 45

Variability in tumour oxygenation

Tumour oxygenation is normally reported as a median value however, there is significant heterogeneity within individual tumours. 5 In addition, microregional oxygenation is unstable, and oxygen levels fluctuate within the tumour depending on the functionality and proximity of local blood vessels. 46 Indeed, it has been shown in rat tumours that some of the variation in oxygenation can be attributed to changes in red cell flux. 47 The “better-oxygenated” tumour cells around functioning capillaries will receive some oxygen, although it is rarely as much as that received by normal cells (Table 2). However, it is sufficient to allow cell division and tumour growth, which is almost certainly boosted by the enhanced level of glycolysis mentioned above. 41 Indeed, it may also be facilitated by an associated reduction in mitochondrial activity. 48 As the cells divide and move away from the capillaries, they receive less oxygen and the more distal cells are chronically hypoxic 49 eventually, the cells die and the tissue becomes necrotic. In histological sections, the viable cells are often seen as “cords” of actively growing cells around perfused blood vessels up to about 150 µm, although this distance is another variable which is variously quoted to range from 70 to 200 µm. 2,47,50,51 The variability is probably related to two main factors: (i) the oxygen requirement of a particular tumour cell type and (ii) its hypoxia tolerance. The more metabolically active the cells, the smaller the tumour cords will be. Once the cells become pathologically hypoxic, the proportion of cells in this fraction will depend on their hypoxia tolerance. The more tolerant they are, the longer they will remain quiescent, yet still viable, resulting in a proportionately more hypoxic tumour with a larger hypoxic fraction. Conversely, hypoxia-sensitive tumour cells will die more quickly, so the hypoxic fraction will be smaller.

In addition, since the blood vessels are inadequate and the lymphatic drainage is nearly non-existent, the interstitial pressure fluctuates, causing intermittent vascular collapse. The cells around a collapsed blood vessel will become “acutely hypoxic” how long this lasts can vary but it has been shown in animal tumours to range from 20 min to several hours. 52,53 Clearly, this is a dynamic situation and again may be much longer/shorter than the figures quoted since the figures relate to the times selected in the published studies (reviewed by Bayer and Vaupel 54 ). Cells in this compartment (if they do not die) are still likely to be in cycle, especially if the acute hypoxia is short. They will be capable of repopulating the tumour more quickly than the “chronically hypoxic” quiescent cells. However, they will be protected from RT (owing to lack of oxygen) or CCT (owing to lack of delivery), if the vessels are closed during the treatment exposure period. There is some evidence to suggest that it is the acutely hypoxic cells that are more likely to contribute to malignant progression. 54–56

Variations in tumour oxygenation readings are therefore to be expected indeed, individual readings do vary across a tumour, albeit at oxygen levels that are mainly in the pathological range. 46 In clinical studies, median levels in different tumour types from different studies are often, though not always, similar (Table 2). This gives confidence that the measurements are real and the medians, although based on a significant spread of individual readings, do provide a genuine indication of the median oxygenation in the tumour mass. In LNCaP xenografts, we have found that the median oxygen level in vehicle-treated tumours is significantly reproducible (discussed below). 44 In humans, it has been shown that the median oxygen level in normal breast tissue was remarkably constant irrespective of the level of haemoglobin in the blood. This was in contrast to breast tumours, which showed both a markedly lower level of pO2 than the normal tissue and also a fall, in this already low level, as the haemoglobin concentration decreased. 57

Tumour hypoxia and malignant progression

Not unsurprisingly, it is now clear that hypoxia causes a multitude of genetic changes predominantly, but not exclusively, mediated through HIF1 and HIF2. 40 As discussed above, in normal cells, HIF1 expression is involved in maintaining tissue oxygenation within normal limits. Its response is designed to be almost instantaneous since the active transcription factor HIF1 is composed of the constitutively expressed HIF1β and the unstable protein HIF1α. The latter is constantly produced and broken down, thereby keeping its level significantly low in physoxic cells. As soon as the oxygen level falls, the removal of HIF1α is inhibited allowing the formation of the HIF1 complex this immediately precipitates a plethora of changes, which in normal cells elicits a return to physoxic conditions. 37,58 However, in tumours, HIF1 expression often persists irrespective of the oxygen level this suggests that there is an adaptive response in tumour cells that makes them much less dependent on oxygen. In some tumour cells, this can be a constitutive change in HIF expression, and, in others, it is caused by a genetic change to one or more of the complex array of proteins that closely control HIF expression in normal cells. 37,58 This establishes a very different phenotype from normal (physoxic) cells. Advantageously, the adapted tumour cells acquire a much reduced requirement for oxygen this leads to a markedly improved ability to survive in hypoxic conditions that is associated with their ability to use glycolysis to provide for their energy needs. 41,48

The switch to a HIF1-regulated phenotype promotes selection for hundreds of genes, many of which are associated with a more malignant phenotype. For example, there is a switch to a more angiogenic phenotype with upregulation of genes, such as vascular endothelial growth factor (VEGF) and interleukin 8 (IL8), whereas angiogenesis inhibitors are downregulated, e.g. angiostatin and endostatin. Other genes/pathways implicated in this hypoxic response include nuclear factor κ B, activator protein-1, mammalian target of rapamycin kinase and the unfolded protein response. 59–61 Although these genes/pathways are activated independently, indicating redundancy in oxygen-sensitive pathways, there is also evidence that they can respond to hypoxia in an integrated manner. 62

Early studies have shown that hypoxia selected for cells with defects in apoptosis. 6 Further reports have confirmed that hypoxia can impose a selection pressure that allows clonal variant expansion in vitro 43,63,64 and in vivo. 55 Studies in our laboratory showed that mice bearing LNCaP xenografts exposed to bicalutamide-induced hypoxia had increased metastasis to the lungs this correlated with an increase in Bcl2 and reduction in Bax. 44 Gene amplification has also been reported in rodent tumour cells exposed ex vivo or in vivo to hypoxia this was associated with an increase in metastases. 65,66 In both tissue culture and animal models, acute hypoxia/reoxygenation have been linked to the induction of DNA strand breaks and clearly, if these breaks are not repaired, they will result in further mutations. Indeed, there is considerable evidence that DNA repair processes in tumours are also modified by hypoxia and that this is related to increases in genetic instability. 67

Other studies have shown that hypoxia can increase malignant progression/metastasis by upregulating metastasis-related genes, such as osteopontin, lysyl oxidase, CXCR4, IL8 and VEGF and many others, primarily through the stabilization of HIF1. 68–70 This may also be associated with an increase in MDM2, which is an inhibitor of p53, and in vivo this leads to apoptosis resistance and increased metastasis formation. 71,72 Recently, it has been shown that radiation treatment can also select for tumour cells that overexpress HIF1. Following irradiation, in vivo HIF1-overexpressing cells relocate towards the tumour blood vessels inhibition of HIF1 blocks this effect and also reduces regrowth of the tumour. 73

It is impossible to discuss all of the genetic changes reported in response to hypoxia (for more detailed reviews see 59,74–76 ). However, there is one issue that needs comment. Genetic changes caused by hypoxia are often measured in vitro and compared with “normoxia”. This is most frequently described, or presumed if undefined, as air containing 5% CO2 (i.e. approximately 20% O2) surprisingly, it is rare to find any comment about the validity of this assumption. However, as discussed above, it would be more relevant to normal tissue if control cells were maintained in physoxia, i.e. 5% O2, and compared with physiological hypoxia (1–3%) and pathological hypoxia (0.5–0.1%). (These figures are given as ranges, as the oxygen level pertinent to a particular investigation will depend on the origin of the tumour and normal tissue of interest—see Table 2 for relevant values.) However, oxygen levels are infrequently taken into account in genetic studies in vitro, although it is likely to be critical to clearly defining and comparing what occurs in whole tissues or tumours.

The lack of correlation between in vitro cells and solid tumours is confirmed in a recent study that identified hundreds of androgen receptor binding sites (ARBSs) in human prostate tumour biopsies. The majority of these ARBSs were not identified in LNCaP prostate tumour cells grown in vitro however, many were found in the same cells grown as xenografts in androgen-deprived (castrated) mice. A 16-gene signature set was identified from the human biopsies that outperformed a larger signature derived from cultured cells it was also identified in the xenografted LNCaP tumours but not in LNCaP cells grown in vitro, indicating that the TME has a major influence in the control of androgen receptor signalling in prostate tumours. 77 This again emphasizes that caution should be used when comparing data from in vitro studies, especially when cells are grown in “normoxia”.

Oxygen homeostasis in the tumour microenvironment and response to treatment

Why do homeostatic mechanisms not respond to restore oxygen homeostasis in tumours? It is clear that angiogenesis is stimulated, but the vasculature formed is insufficient to maintain oxygen at physoxic levels despite extensive capillary formation in many tumours. If, in response to a prolonged hypoxic stress, the tumour cells adapt/mutate to produce even more amplified levels of pro-angiogenic factors, then they will provide the tumour with a survival advantage. Once the pro-angiogenic factors get to critical levels, then the vasculature will improve (possibly normalize) 78 and the tumour will regrow. Unfortunately, when this happens, it is likely to be repopulated with pro-angiogenic, hypoxia-tolerant, more malignant tumour cells.

This is exactly what happened when mice bearing LNCaP tumours were treated daily with bicalutamide, a drug widely used in locally advanced prostate cancer. Untreated LNCaP xenografts were poorly oxygenated (0.8% oxygen 6 mmHg) this was similar to oxygen levels found in clinical studies (0.9% oxygen, 7 mmHg Table 2). When mice were treated daily with bicalutamide for 28 days, the oxygen level dropped precipitately over 1–3 days to ≤0.1% oxygen this profound hypoxia was maintained for more than 10 days. However, during the next 10 days, oxygen levels increased, returning to almost pre-treatment levels. When tumours were grown in vivo in window chambers, a marked loss of blood vessels was seen in the first 14 days of bicalutamide treatment followed by an angiogenic burst. This distinctive biphasic response was attributed to a small fall, and then a larger increase, in pro-angiogenic factors, including VEGF and most markedly IL8. Clearly, the tumour cells can survive exposure to the profound hypoxic insult and, despite the androgen blockade, growth inhibition was eventually reversed by the production of sufficient pro-angiogenic factors to stimulate neovascularization. The tumour cells were clearly able to switch use of their limited energy supply to synthesize these critical factors. After 28 days of treatment, excised tumour cells were more invasive and more resistant to docetaxel than tumour cells excised from a vehicle-treated mouse. In addition, mice treated with bicalutamide had a marked increase in metastatic spread to the lungs, although this could be blocked successfully by treatment on Day 7 with a single dose of banoxantrone (AQ4N), a prodrug that specifically targets hypoxic cells. 44

The initial antivascular effect of the anti-androgen bicalutamide is not widely recognized, although previous studies, mostly using castration models, have provided much evidence that it is likely to occur (discussed in 44 ). Our studies showed that prostate tumour cells are very hypoxia tolerant. In other tumour types, this may vary somewhat however, it should be noted that pancreatic tumour cells may be particularly hypoxia tolerant because they survive oxygen levels ≥19-fold lower than those found in normal pancreatic tissue (Table 2). 23 When patient-derived xenografts were established orthotopically in nude mice, the extent of hypoxia, measured using the hypoxic marker EF5, predicted for aggressive growth and spontaneous metastasis. 79 Human pancreatic tumours are particularly treatment resistant, a characteristic that has been attributed to their extensive stroma. 80 It is tempting to speculate that treatment resistance may also result from the selection for cells that have the ability to survive oxygen levels much lower than those found in the normal pancreas and which, consequently, have a particularly malignant phenotype.

If exposure to drugs which cause hypoxia can select for hypoxia-tolerant/more malignant tumour cells, it is possible that any treatment that causes increased and prolonged hypoxia can do the same thing. This may be the foremost reason why vascular targeting drugs, used as single agents, are not as successful as originally expected. Indeed, considerable redundancy in angiogenic pathways has been observed and revascularization has also been found after initial early antivascular responses (for review see 81 ). Most anticancer treatments either (i) target blood vessels directly or (ii) target the tumour cells that support the functioning, however inadequately, of the tumour vasculature. Therefore, it is possible that many treatments cause early (often unrecognized) antivascular effects and an associated increase in hypoxia. Since the oxygen levels in most tumours are already in the pathological range, this may well result in a critical hypoxic insult.

We have shown this in PC3 prostate tumours with the cytotoxic drug docetaxel, which caused an early antiangiogenic effect that was further potentiated with dexamethasone. This may explain why there is a short-term (although not long-term) efficacy of this combination in patients with metastatic prostate cancer. 82 As discussed above, the antiandrogen bicalutamide has a similar initial and profound effect on tumour vasculature, an effect that we have also found with other mechanistically different antitumour drugs (our unpublished data). However, tumours can adapt to this hypoxic insult and they recover with a more pro-angiogenic, and potentially malignant, phenotype. 44,83,84 This problem may be overcome in part, at least, by combination with other CCT. Hypoxia-activated prodrugs (HAPs) (discussed below) offer an additional approach, since they specifically target hypoxic cells. Clearly, a greater understanding of longitudinal changes in tumour oxygenation induced by current therapies is required, to more effectively schedule drug combinations, including HAPs.


1 INTRODUCTION

T cells and especially cytotoxic CD8 + T lymphocytes (CTLs) have long been recognized to be important in limiting the development of immunogenic tumors. 1 The presence of CTLs within many tumors is hence a positive prognostic factor. 2 Conversely, impaired antitumoral immune response is a hallmark of growing tumors. 3 The concept of T cell-driven immunosurveillance against cancer has led to the development of immunotherapies based either on the reinvigoration of T cell function in situ, mainly via antibodies targeting immune checkpoint receptors, or on the transfer of genetically modified autologous T cells with enhanced antitumoral activity, mainly chimeric antigen receptor (CAR)-expressing T cells. 4 Both strategies have provided an unprecedented level of long-term antitumor activity in patients with several metastatic cancers. However, the majority of patients with advanced cancers still do not experience sustained clinical benefit from immunotherapy, highlighting the presence of barriers that one needs to identify in order to design strategies that overcome them. Ineffective T cell migration and, in particular, penetration into the tumor mass might represent an important obstacle to T cell based immunotherapies. As a support for this notion, various clinical studies have shown that tumors enriched in T cells are more susceptible to be controlled by programmed cell death-1 (PD-1) blockade. In contrast, tumors with so-called “immune deserts” and immune excluded profiles, in which T cell are present within tumors but not in contact with malignant cells, are refractory to PD-1 blockade. 5 Migration might represent an even greater challenge for CAR T cell therapy, because the in vitro expanded T cells that are infused into the blood circulation need to home to the site of tumor development and then migrate toward the tumor mass.

There is currently a wide gap in our knowledge of the homing and migratory properties of CAR T cells, as well as to the location of these therapeutic cells over prolonged periods. The objective of this review is therefore to address key open questions, such as: what are the capacities of infused therapeutic T cells to home to target organs? How does the tumor microenvironment influence the motility behavior of engineered T cells? What are the strategies, which have been implemented to restore a defective CAR T cell migration? How should homing and motility properties of adoptively transferred T cells be monitored in preclinical models? By highlighting these points, we hope to stimulate a research focus at the interface between basic T cell biology and therapeutic development that will ultimately open new opportunities to improve antitumoral T cell based strategies.


Hypoxia Diminishes Electron Transport

Multiple studies throughout the 1970s and 1980s examined the oxygen dependence of the ETC (108, 109). These studies observed that exposure of cells to acute hypoxia (minutes to seconds) did not attenuate the flux of electrons through the ETC nor increase NADH levels in mitochondria. However, in the mid-1990s we reported that isolated mitochondria decreased coupled respiration and that isolated COX decreased its maximal velocity (Vmax) when exposed to chronic hypoxia (2 h) (30, 32). Thus there is an intrinsic oxygen dependence of COX during prolonged hypoxia. Another important regulator of COX activity is nitric oxide (NO) (36). Low concentrations (nM range) of NO reversibly inhibit isolated COX by competing with oxygen (15, 35, 80). Under aerobic conditions, oxygen levels are high enough to prevent NO from inhibiting COX activity (36). However, as oxygen levels fall, the low levels of NO are sufficient to inhibit COX activity. Low levels of NO under normoxia do not injure cells. However, the same low levels of NO are sufficient to inhibit respiration and initiate cell death under hypoxia (1.5% O2) (76). In the absence of NO, hypoxia alone does not have any deleterious effects on cells. It is likely that COX activity is compromised in inflammatory conditions where NO levels are high with concomitant tissue hypoxia. Furthermore, the NO-generating enzyme inducible NO synthase (iNOS) is a target of HIF-1 (65, 85). We propose that hypoxia diminishes COX activity by decreasing the Vmax of COX activity and by increasing NO levels to inhibit COX activity. Although this mechanism diminishes COX activity during hypoxia, the activity cannot be diminished to the point where respiration fails to meet the basal metabolic demands of cells. Therefore, cells ensure optimal COX activity during hypoxia by activating HIF-1 to induce subunit switch from COX4–1 subunit to COX4–2 (44). COX has 13 subunits, of which the three catalytic subunits COX I-III are encoded by mitochondrial DNA. The remaining regulatory 10 subunits including COX4 subunits are encoded by nuclear DNA. HIF-1 induces both the expression of the COX4–2 subunit and the mitochondrial protease LON, which targets COX4–1 subunit degradation to complete the switching of the COX4 subunits during hypoxia. Recently, another mechanism to downregulate the ETC is the finding that micro-RNA 210 (mir-210) blocks the expression of the iron-sulfur cluster assembly proteins ISCU1/2, which are required for the functions of complex I, COX subunit 10, aconitase, and subunit D of succinate dehydrogenase (28, 33, 42, 91). Using a miRNA microarray, Kulshreshta et al. (74) first discovered that miR-210 is regulated by hypoxia, and recently it was proposed to be the major micro-RNA upregulated during hypoxia. HIF-1, but not HIF-2, is responsible for the induction of mir-210 during hypoxia (57). The ectopic expression of mir-210 is sufficient to decrease mitochondrial respiration and upregulate glycolysis (33). Thus there are multiple mechanisms by which HIF-1 can coordinately diminish electron flux through the ETC (Fig. 3).

Fig. 3.Hypoxia diminishes electron flux through the electron transport chain. Hypoxia diminishes respiratory activity by activating HIF-1, which increases micro-RNA 210 (miR-210), inducible nitric oxide synthase (iNOS), and switching of cytochrome c oxidase (COX)4–1 subunit to COX4–2. Hypoxia can also directly decrease complex IV (COX) activity.


3 RESULTS

3.1 Patient demographics

Table 1 summarizes the basic characteristics of the 70 patients (NACRT and US groups). In the NACRT group, the median age of the patients was 66 years, and 24 of them (60%) were male. NACRT was performed in three patients with R-PDAC, 35 patients with BR-PDAC, and two patients with LA-PDAC. A pancreatoduodenectomy was performed in 31 patients (79%). The NACRT group had a higher proportion of pretreatment diagnosis for BR- or LA-PDAC (93% vs 53%, P < .01) and a lower percentage of lymph node metastasis (40% vs 80%, P < .01) compared with the US group. However, the differentiation status of tumors, tumor size, and proportion of resection margin–negative were similar between the two groups.

Characteristics NACRT US NACRT vs US
N = 40 N = 30 P value
Age (y) 66 (51-78) 68 (52-84) .44
Male gender 24 (65%) 16 (53%) .28
Pretreatment diagnosis: R/BR/LA 3 (8%)/35 (88%)/2 (5%) 14 (47%)/16 (53%)/0 <.01
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 4 (10%) 0 .07
ypTS 2.7 (0.9-5.5) 2.9 (1.0-4.3) .14
Nodal metastasis 12 (40%) 24 (80%) <.01
Stage IA/IB/IIA/IIB/III 10 (25%)/17 (43%)/1 (3%)/9 (23%)/3 (8%) 3 (10%)/5 (17%)/0/16 (53%)/6 (20%) .01
Treatment effect, Evans grade I/IIA/IIB/III 9 (19%)/20 (50%)/8 (20%)/3 (8%) - -
Resection margin–negative 34 (85%) 23 (77%) .28
Recurrence 28 (70%) 20 (67%) .77
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced NACRT, neoadjuvant chemoradiotherapy R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy US, upfront surgery.

3.2 Immune cell distribution according to preoperative treatment

As shown in Figure 2, all immune cells were present in both the cancer stroma and the cancer cell nests of PDAC samples. These cells were found to be more abundant in the cancer stroma than in the cancer cell nest regardless of preoperative therapy. Figure 2 shows a comparison of immune cell distributions between the NACRT and US groups. Although the cancer stromal counts of CD4+ T cells, CD20+ B cells, and Foxp3+ T cells in the NACRT group were drastically decreased compared with those in the US group, these counts in the cancer cell nests were not different between the two groups. In contrast, CD204+ macrophage counts in the cancer stroma were similar between the NACRT and US groups, whereas those in the cancer cell nests were significantly reduced in the NACRT group. PD-L1+ carcinoma cell counts in the NACRT group were substantially lower in comparison with the US group (Table 2). These results suggest that alterations in TIICs following NACRT appear to be very different from those in cancer stromal immune cells.

Characteristics (count/mm 2 ) NACRT US NACRT vs US
N = 40 N = 30 P value
CD3+ CD4+ T cell (stroma) 77.5 (13.5-365.7) 92.9 (4.9-397.0) .561
CD3+ CD4+ T cell (cancer cell nest) 9.0 (0.0-82.6) 4.4 (0.0-38.2) .056
CD3+ CD8+ T cell (stroma) 77.3 (17.9-418.8) 139.6 (25.2-684.3) .017
CD3+ CD8+ T cell (cancer cell nest) 16.4 (0.0-173.3) 19.7 (3.5-262.1) .367
CD20+ B cell (stroma) 1.3 (0.0-18.9) 16.5 (0.0-253.4) < .001
CD20+ B cell (cancer cell nest) 0.0 (0.0-11.9) 0.0 (0.0-5.6) .100
CD3+ Foxp3+ T cell (stroma) 4.4 (0.0-73.5) 19.4 (0.1-118.6) .005
CD3+ Foxp3 + T cell (cancer cell nest) 0.5 (0.0-17.0) 1.8 (0.0-17.4) .072
CD204+ cell (stroma) 252.4 (53.0-959.6) 278.6 (2.7-693.8) .302
CD204+ cell (cancer cell nest) 16.7 (0.0-137.6) 56.3 (6.1-150.0) .001
PD-L1 high carcinoma 0.0 (0.0-25.4) 2.2 (0.0-521.3) < .001

3.3 Association between TIICs and early recurrence of disease in the NACRT group

The count of each immune cell found in carcinomas was divided into low and high groups according to the cutoff value (set as the median amount). Kaplan-Meier curve analysis demonstrated that only patients with high CD204+ macrophage counts in the cancer cell nest (>16.7 counts/mm 2 ) had significantly shorter RFS times compared with patients with low CD204+ macrophage counts in the cancer cell nest (Figure 3). Univariate and forest plot analyses suggested that high PD-L1 expression and the presence of CD204+ macrophages in the cancer cell nest were associated with shorter RFS (Table 3 and Figure S2). Following multivariate analysis, only high CD204+ macrophage counts in the cancer cell nest remained an independent predictor of shorter RFS (Table 3). There were no significant differences in the basic characteristics between the groups with high and low CD204+ macrophage counts in the cancer cell nest (Table 4).

Variables Univariate Multivariate
MRFS (months) P value OR (95% CI) P-value
CD3+ CD4+ T cell (cancer cell nest) < 9.0 13.5 .360
>9.0 18.7
CD3+ CD8+ T cell (cancer cell nest) < 16.4 15.2 .622
>16.4 12.9
CD20+ B cell (cancer cell nest) < 0.0 15.2 .747
>0.0 6.6
CD3+ Foxp3+ T cell (cancer cell nest) < 0.5 13.5 .667
>0.5 18.7
CD204+ cell (cancer cell nest) < 16.7 25.0 .032 2.366 (1.074-5.215) .033
>16.7 6.9
PD-L1 high carcinoma (cancer cell nest) < 0.0 22.5 .091 2.001 (0.912-4.390) .084
>0.0 6.9
Characteristics High CD204+ (cancer cell nest) Low CD204+(cancer cell nest) High vs low
N = 20 N = 20 P-value
Age (y) 66 (51-78) 66 (54-78) .34
Male gender 14 (70%) 10 (50%) .17
Pretreatment diagnosis: R/BR/LA 2 (10%)/16 (80%)/2 (10%) 1 (5%)/19 (95%)/0 .27
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 2 (10%) 2 (10%) 1.00
ypTS 2.5 (0.9-5.5) 3.0 (1.0-4.0) .51
Nodal metastasis 4 (20%) 8 (40%) .17
Resection margin–negative 3 (15%) 3 (15%) 1.00
Recurrence 16 (80%) 12 (60%) .15
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy ypTS, pathological tumor size.

Tight Control of Hypoxia-inducible Factor-α Transient Dynamics Is Essential for Cell Survival in Hypoxia

Intracellular signaling involving hypoxia-inducible factor (HIF) controls the adaptive responses to hypoxia. There is a growing body of evidence demonstrating that intracellular signals encode temporal information. Thus, the dynamics of protein levels, as well as protein quantity and/or localization, impacts on cell fate. We hypothesized that such temporal encoding has a role in HIF signaling and cell fate decisions triggered by hypoxic conditions. Using live cell imaging in a controlled oxygen environment, we observed transient 3-h pulses of HIF-1α and -2α expression under continuous hypoxia. We postulated that the well described prolyl hydroxylase (PHD) oxygen sensors and HIF negative feedback regulators could be the origin of the pulsatile HIF dynamics. We used iterative mathematical modeling and experimental analysis to scrutinize which parameter of the PHD feedback could control HIF timing and we probed for the functional redundancy between the three main PHD proteins. We identified PHD2 as the main PHD responsible for HIF peak duration. We then demonstrated that this has important consequences, because the transient nature of the HIF pulse prevents cell death by avoiding transcription of p53-dependent pro-apoptotic genes. We have further shown the importance of considering HIF dynamics for coupling mathematical models by using a described HIF-p53 mathematical model. Our results indicate that the tight control of HIF transient dynamics has important functional consequences on the cross-talk with key signaling pathways controlling cell survival, which is likely to impact on HIF targeting strategies for hypoxia-associated diseases such as tumor progression and ischemia.

Author's Choice—Final version full access.

Both authors contributed equally to this work.

Recipient of a Biotechnology and Biological Sciences Research Council doctoral training studentship.

Holds University of Liverpool studentship.

Recipient of a Medical Research Council capacity building studentship.

Present address: Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom.


Introduction

Skeletal muscles undergo structural and functional adaptations to various stimuli including mechanical (e.g., exercise) and environmental (e.g., systemic hypoxia) stimuli. Endurance exercise training results in improved muscle oxidative capacity (Holloszy and Booth 1976 ), whereas resistance exercise training leads to increases in muscle size and strength (McDonagh and Davies 1984 ). Endurance exercise training (5–6 times/week for 3–6 weeks at 70–80% maximal oxygen uptake) performed in systemic hypoxia induces a greater increase in muscle oxidative capacity when compared to endurance exercise training under normoxia (Desplanches et al. 1993 Geiser et al. 2001 ). This suggests that skeletal muscle adaptations are specific to the type of exercise stimuli, and that the combination of exercise and systemic hypoxia may have a synergistic effect on skeletal muscle adaptations such as muscular endurance.

It is generally recognized that endurance exercise training causes a significant increase in skeletal muscle capillarization, characterized by an elevated capillary density and capillary-to-fiber ratio (Andersen 1975 Brodal et al. 1977 Hudlicka et al. 1992 ). This physiological adaptation contributes to enhanced aerobic capacity via an increase in the transport, conductance, and extraction of oxygen in skeletal muscle. Vascular endothelial growth factor (VEGF) (Folkman and Shing 1992 Hudlicka et al. 1992 van Weel et al. 2004 Olfert et al. 2009 ), the generation of nitric oxide by nitric oxide synthase (NOS) (Baum et al. 2004 , 2013 ), and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (Arany et al. 2008 Leick et al. 2009 ) are positive regulators of angiogenesis in skeletal muscle. Among these regulators, VEGF is known to play a critical role in increasing angiogenesis. When compared with wild-type mice, VEGF transgenic mice (van Weel et al. 2004 ) and muscle-specific VEGF knock-out mice (Olfert et al. 2009 ), respectively, have increased and decreased skeletal muscle capillary density. Both NOS (Baum et al. 2013 ) and PGC-1α (Leick et al. 2009 ) knock-out mice have decreased skeletal muscle VEGF expression and capillary-to-fiber ratio. Acute high-intensity resistance exercise (three sets of 10 repetitions of two legged knee extensor exercise at 60–80% of 1RM) in humans increases the expression of skeletal muscle VEGF mRNA and protein (Gavin et al. 2007 ). Hypoxic stimuli in cells also increase VEGF mRNA levels through the activation of the nuclear transcription factor, hypoxia-inducible factor-1 (HIF-1) (Forsythe et al. 1996 ). Thus, it is possible that resistance exercise training under systemic hypoxia, when compared with normoxia, causes a greater increase in skeletal muscle VEGF and capillarization potentially leading to increased muscular endurance.

Therefore, this study investigated the effects of resistance exercise training under systemic hypoxia on the angiogenic response and muscular endurance in human skeletal muscle. We hypothesized that resistance exercise training under systemic hypoxia would lead to a greater development of muscular endurance and greater increase in angiogenic and mitochondrial responses as demonstrated by increases in VEGF, PGC-1α, NOS, and capillary-to-fiber ratio.


4 EXPERIMENTAL PROCEDURES

4.1 Chick embryos

According to Swedish regulations (Jordbruksverkets föreskrift L150, §5) work on chick embryos younger than embryonic day 13 do not require Institutional Animal Care and Use Committee oversight.

4.2 Human and mouse fetal tissue

Human fetal tissue (ethical approval Dnr 6.1.8-2887/2017, Lund University, Sweden) was obtained from elective abortions. Tissue samples were dissected in custom-made hibernation medium (Life Technologies, Carlsbad, California) and fixed in 4% formaldehyde overnight. Following a sucrose gradient, embryos were embedded in gelatin for transverse sectioning at 12 μm (ew5) or 7 μm (ew6) using a cryostat.

4.3 Cell culture

The human neuroblastoma cell line SK-N-BE(2)c (ATCC Manassas, Virginia) was cultured in MEM supplemented with 10% fetal bovine serum and 100 units penicillin and 10 μg/mL streptomycin. As part of our laboratory routines, all cells were maintained in culture for no more than 30 continuous passages and regularly screened for mycoplasma. SK-N-BE(2)c cells were authenticated by SNP profiling (Multiplexion, Germany).

4.4 Embryos and perturbations

Chick embryos were acquired from commercially purchased fertilized eggs and incubated at 37.5°C until desired developmental Hamburger Hamilton (HH) stages were reached. 10 Optimal conditions for high transfection efficiency applying one-sided electroporation in ovo were determined to 5 pulses of 30 ms each at 22 V. Ringer's balanced salt solution (solution-1:144 g NaCl, 4.5 g CaCl•2H2O, 7.4 g KCl, ddH2O to 500 mL solution-2:4.35 g Na2HPO4•7H2O, 0.4 g KH2PO4, ddH2O to 500 mL [adjust final pH to 7.4]) containing 1% penicillin/streptomycin was used in all experiments. Morpholinos used were from GeneTools with the following sequences splice targeting EPAS1 oligo (5′-GAAAGTGTGAGGGAACAAGTTACCT-3′) and a corresponding 5′-mispair oligo (5′-GAtAcTGTcAGGcAACAAcTTACCT-3′). Morpholinos were injected at a concentration of 1 mM and co-electroporated with a GFP tagged empty control vector (1 μg/μL). RFP-tagged EPAS1 overexpression construct or corresponding empty control vector were electroporated at a concentration of 2.5 μg/μL. CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′ EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc 3′ EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9-GFP (#99138, Addgene) at 2 μg/μL. 40 All constructs were injected at HH stage 10+/11 into the lumen of the neural tube from the posterior end and embryos were electroporated in ovo applying electrodes 4 mm apart, covering the whole embryo. One-sided electroporation was performed to allow for an internal control side within each individual embryo. Embryos were allowed to sit at room temperature for 6 to 10 hours before further incubation of the embryos at 37.5°C in order to allow the Cas9 protein to fold. Importantly, apart for analysis on embryo growth (ie, age determination), all analyses were performed on sections/cells at the trunk axial level of the embryo.

For harvesting of tissue for RNA extraction, embryos were incubated at 37.5°C for 24 (morpholinos and overexpression vectors) or 36 (CRISPR/Cas9) hours postelectroporation. The trunk portion of neural tubes was dissected and immediately snap frozen before RNA extraction and qPCR analysis.

4.5 Cloning

To overexpress HIF-2α, the Gallus gallus EPAS1 coding sequence was amplified using the following primers Fwd:

5′AAACTCGAGGCCACCATGGACTACAAAGACGATGACGACAAGGCAGGTATGACAGCTGACAAGGAGAAG-3′, Rev 5′-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3′ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting, oligos designed to target EPAS1 at three different locations (EPAS1.1, EPAS1.2, and EPAS1.3) were annealed pairwise at a concentration of 100 μM per oligo using T4 DNA Ligase Buffer in dH2O by heating to 95°C for 5 minutes. The annealed oligo reactions were cooled to room temperature and diluted. The U6.3 > gRNA.f + e (#99139, Addgene) vector was digested over night with BsaI-HF enzyme (New England Biolabs) and gel extracted. gRNAs were cloned into the digested U6.3 > gRNA.f + e vector using T4 DNA Ligase (New England Biolabs) at room temperature for 20 minutes. Successful inserts were identified by colony PCR using U6 sequencing primer and gRNA reverse oligo specific to each EPAS1 gRNA.

4.6 Neural tube dissections for crestosphere cultures

Neural tubes from respective axial levels were carefully dissected out from embryos at designated somite stages. For cranial-derived cultures, the very anterior tip was excluded, and the neural tube was dissected until the first somite level as previously described. 26 For trunk-derived cultures, the neural tube was dissected between somite 10 to 15 as previously described. 24, 25 Pools of neural tubes from four to six embryos were used for each culture.

4.7 Crestosphere cell culture

Neural tube derived cells were cultured in NC medium (DMEM with 4.5 g/L glucose (Corning), 7.5% chick embryo extract (MP Biomedicals, Santa Ana,California), 1X B27 (Life Technologies), basic fibroblast growth factor (bFGF, 20 ng/mL) (Peprotech, Stockholm, Sweden), insulin growth factor-I (IGF-I, 20 ng/mL) (Sigma Aldrich, Darmstadt, Germany), retinoic acid (RA 60 nM for cranial and 180 nM for trunk, respectively) (Sigma Aldrich), and 25 ng/mL BMP-4 (for trunk) (Peprotech)) in low-adherence T25 tissue culture flasks as described previously. 24, 25

4.8 Self-renewal assay

Chick embryos at developmental HH stage 10+/11 were injected and electroporated with CRISPR/Cas9 constructs and allowed to develop at 37.5°C to reach HH stage 13 + /14 − . Crestosphere cultures were established from embryos electroporated with control, EPAS1.1 or EPAS1.2 constructs. Crestospheres were dissociated into single cells using Accutase (Sigma Aldrich incubation at 37°C for 40 minutes with 1 minute of pipetting every 10 minutes), and individual cells were manually picked using a p10 pipette tip under a microscope. Single cells were transferred to 96-well plates prepared with 100 μL of NC medium supplemented with RA and BMP-4. 25 The absolute number of spheres formed in each well was quantified manually under the microscope. Sphere diameter was manually measured using the ImageJ software (spheres measured n = 33 and n = 27 for CTRL and EPAS1.2, respectively).

4.9 EdU pulse chase labeling

Proliferation was measured using the Click-iT EdU Cell Proliferation kit (Invitrogen #C10337) according to the manufacturer's recommendations with optimizations from Warren et al. 23 Chick embryos at developmental HH stage 10+/11 were injected and electroporated with morpholino or overexpression constructs and allowed to develop for an additional 24 hours at 37.5°C. Eggs were then reopened and EdU solution (500 μM in PBS-DEPC) was added. Eggs were resealed and incubated at 37.5°C for another 4 hours before dissection in Ringer's solution and fixed in 4% paraformaldehyde overnight. Embryos were washed in PBS-DEPC, H2O, and 3% BSA in PBS-DEPC before permeabilization in 0.5% Triton-X. Embryos were hybridized in reaction cocktail (Click-iT Reaction buffer, CuSO4, Alexa Fluor 488 Azide and reaction buffer additive), washed and DAPI stained. Embryos were after another round of washing processed through a sucrose gradient and embedded in gelatin.

4.10 Whole mount in situ hybridization

For whole mount in situ hybridization, embryos were fixed in 4% PFA and washed in DEPC-PBT. Samples were gradually dehydrated by bringing them to 100% MeOH and kept at −20°C until use. In situ hybridization was performed as previously described. 41 Embryos were rehydrated back to 100% PBT, treated with Proteinase K/PBT, washed in 2 mg/mL glycine/PBT and postfixed in 4% paraformaldehyde/0.2% glutaraldehyde for 20 minutes. Embryos were then prehybridized in hybridization buffer for 2 hours at 70°C and hybridized with Digoxigenin (DIG)-labeled TFAP2B probe overnight at 70°C. Embryos were washed in wash solutions I and II (50% formamide, 1% sodium dodecyl sulfate [SDS] and 5X SSC [NaCl and Na citrate] or 2X SSC, respectively), and blocked in 10% sheep serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST/1% sheep serum overnight at 4°C. On day 3, embryos were washed in TBST throughout the day and overnight. Embryos were washed in alkaline phosphatase buffer (NTMT 100 mM NaCl, 100 mM Tris-Cl [pH 9.5], 50 mM MgCl2, 1%Tween-20) before visualizing the signal using NBT/BCIP (Sigma Aldrich). Stained embryos were rinsed in PBT for 20 minutes and postfixed in 4% PFA/ 0.1% glutaraldehyde overnight when considered complete. Embryos were then dehydrated in MeOH to be stored at −20°C. Embryos were later embedded in blocks of gelatin for transverse sectioning at 8 μm using a cryostat. Hybridization probe for avian TFAP2B was a kind gift from Dr Felipe Vieceli.

4.11 RNA sequencing

Chick embryos of stage HH10+/11 were from the posterior end injected with EPAS1 targeting or corresponding 5′-mispair morpholinos into the lumen of neural tubes and subsequently electroporated for construct uptake. Following 24 hours of incubation at 37.5°C, embryos were removed from the eggs in Ringer's solution. The neural tube portion at the trunk axial level of individual embryos were carefully dissected, removing surrounding mesodermal tissue, and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen. RNA was extracted from each individual neural tube (five samples per condition [EPAS1 and 5′-mispair, respectively]) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina). Alignment of reads was performed using the HISAT2 software and the reference genome was from the Ensemble database (Gallus gallus 5.0). Expression counts were performed using the StringTie software and DEG analysis was performed using DESeq2. To obtain a relevant working list out of the 1105 significantly DEGs, we set a cut-off at P < .005 and removed all hits that were NA, ending up with 97 genes. Significance (P values) was DESeq2 derived. 42 RNA sequencing data have been deposited in NCBI's Gene Expression Omnibus 43 and are accessible through GEO Series accession number GSE140319.

4.12 Bioinformatics

GSEA for gene ontology, network and functional analyses were generated through the use of Panther database (analyses performed autumn 2018 (http://pantherdb.org/) 44 together with the Ingenuity Pathway Analysis (IPA) software 45 (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis). For a hypothesis-free/exploratory analysis of the 97 DEGs, IPA was used (P-value calculations using right-tailed Fisher Exact Test). IPA was mainly used for deeper exploration of the data where the biological hypotheses generated for the project were further explored. Here, a hypotheses-driven approach was taken where the following categories found from the IPA analysis of the 97 DEGs were further investigated “Cellular Movement,” within the “Molecular and Cellular Function” result category, “Embryonic Development,” within the category “Physiological System Development and Function,” and “Tumor Morphology,” within the “Disease and Disorders” category. These three biological networks were further investigated within the data set at hand. The investigation for the possible overlap and connections between these networks in the context of the data were hence explored.

4.13 Cryosections

Fixed embryos were incubated in a sucrose gradient (5% sucrose for 10 minutes and 15% sucrose for 10 minutes up to several hours) followed by incubation in 7.5% gelatin over night at 37°C. Gelatin embedded samples were cryosectioned at 7 to 20 μm.

4.14 Immunohistochemistry and immunofluorescence

Immunohistochemistry on mouse fetal tissue for HIF-2α (NB100-132, Novus Biologicals) and TH (ab112, Abcam) was performed using Autostainer (Dako). Sections were counterstained with hematoxylin. Detection of HIF-2α by immunofluorescence was performed on sections from the trunk axial level of embryos (avian and human) that had been harvested, fixed as whole embryos in 4% PFA overnight, incubated in 5% sucrose for 10 minutes, 15% sucrose for 4 hours and gelatin overnight. Embryos were then embedded in gelatin and snap frozen. Dry embryo sections were incubated in ice-cold acetone followed by 0.3% Triton-X in PBS. After washing in PBS, slides were blocked in DAKO serum-free ready-to-use block (DAKO, #X0909) for 1 hour before incubation with primary antibodies (in DAKO antibody diluent with background reducing components [DAKO, #S3022]) overnight (HIF-2α, ab199, Abcam HNK-1, 3H5, DSHB). Slides were washed in PBS and incubated with rabbit linker (DAKO, #K8019) followed by secondary antibody in 1% BSA/PBS. Detection of HNK1 and SOX9 by immunofluorescence was performed by blocking (10% goat serum and 0.3% Triton-X in TBST) of embryo sections followed by incubation with primary antibodies (SOX9, ab5535, Millipore) over night at +4°C. Slides were washed and incubated with secondary antibodies and DAPI for nuclear staining for 1 hour at RT before washing and mounting. Fluorescent images were acquired using an Olympus BX63 microscope, DP80 camera, and cellSens Dimension v 1.12 software (Olympus Cooperation). Detailed information on antibodies can be found in Table 6.

Species Dilution Source Product #
IF antibodies
Primary antibody
HNK1 Mouse 1:5 Hybridoma bank 3H5
HIF-2α Rabbit 1:50 Abcam ab199
SOX9 Rabbit 1:1000 Millipore ab5535
Secondary antibody
Anti-mouse Alexa Fluor-594 Goat 1:1000 Invitrogen A-11032
Anti-rabbit Alexa Fluor-546 Donkey 1:1000/1:500 Invitrogen A-10040
Anti-mouse Alexa Fluor-488 Goat 1:1000 Invitrogen A-11008
IHC antibodies
Primary antibody
HIF-2α Mouse 1:1000 Novus Biologicals NB100-132
HIF-2α Rabbit 1:4000 Abcam ab199
TH Rabbit 1:1600 Abcam ab112
In situ antibodies
Anti-dig-AP Mouse 1:2000 Roche Diagnostics 11 093 274 910
Nuclear staining
DAPI 1:3000 Dako D3571
Western blot antibodies
Primary antibody
HIF-2α Rabbit 1:200 Abcam ab199
SDHA Mouse 1:4000 Abcam ab14715
Secondary antibody
Anti-rabbit Monkey 1:3000 Invitrogen 65-6120
Anti-mouse Sheep 1:5000 Invitrogen 62-6520

4.15 Western blot

Extracted proteins were separated by SDS-PAGE, transferred to HyBond-C-Extra nitrocellulose membranes, blocked, and incubated with primary antibodies (HIF-2α, ab199, Abcam SDHA, ab14715, Abcam) at 4°C overnight. The next day, membranes were incubated with HRP-conjugated antibodies and proteins detected by ECL solution. Detailed information on antibodies can be found in Table 6.

4.16 RNA extraction and quantitative real-time PCR

Total RNA was extracted using the RNAqueous Micro Kit (Ambion, #AM1931). cDNA synthesis using random primers and qRT-PCR was performed as previously described. 27 Relative mRNA levels were normalized to expression of two reference genes (18S, 28S) using the comparative Ct method. 46 Detailed information of primer sequences can be found in Table 7.

Target gene 5′-3′
18S (reference gene) Fwd CCATGATTAAGAGGGACGGC
Rev TGGCAAATGCTTTCGCTTT
28S (reference gene) Fwd GGTATGGGCCCGACGCT
Rev CCGATGCCGACGCTCAT
EPAS1 Fwd GGCACCAATACCATGACGA
Rev CATGTGCGCGTAACTGTCC
SOX10 Fwd AGCCAGCAATTGAGAAGAAGG
Rev GAGGTGCGAAGAGTTGTCC
B3GAT1 Fwd TTGTGGAGGTGGTGAGGA
Rev GGCTGTAGGTGGGTGTAATG
TFAP2B Fwd CCCTCCAAAATCCGTTACTT
Rev GGGGACAGAGCAGAACACCT
HOXC9 Fwd TAAGCCACGAAAACGAAGAG
Rev GAAGGAAAGTCGGCACAGTC
HOXA2 Fwd AGGCAAGTGAAGGTCTGGTT
Rev TCGCCGTTCTGGTTCTCC
NGFR Fwd AGCAGGAGGAGGTGGAGAA
Rev CCCGTGTGAAGCAGTCTATG
HES6 Fwd GCTGATGGCTGATTCCAAAG
Rev TCGCAGGTGAGGAGAAGGT
AGPAT4 Fwd TGCTGGGCGTTCTAAATGG
Rev ACACTCCTGCTCATCTTCTGG
HES5 Fwd GTATGCCTGGTGCCTCAAA
Rev GCTTGTGACCTCTGGAAATG
RASL11B Fwd GCTGGGCTGTGCTTTCTATG
Rev GGTGCTGGTGGTCTGTTGTT
FMN2 Fwd CCATCAGCCAGTCAAGAGGA
Rev TAAAGCATCGGGAGCCAAAC
TAGLN3 Fwd AGGCAGCATTTCCAGACC
Rev ATGGGTTCGTTTCCCTTTG
NRCAM Fwd TCATTCCGTGTGATTGCTGT
Rev AAGGATTTTCATCGGGGTTT
EGFP Fwd CCGACCACTACCAGCAGAAC
Rev TTGGGGTCTTTGCTCAGG

4.17 RNAi experiments

SK-N-BE(2)c cells were transfected with ON-TARGETplus Nontargeting Control siRNA #2 (D-001810-02-05), ON-TARGETplus siRNA Targeting human HIF1Α (J-004018-07) or ON-TARGETplus siRNA Targeting human EPAS1 (J-004814-06), all from Dharmacon, using Lipofectamine 2000 or RNAiMAX. Cells were then placed in 21% or 1% oxygen for 48 hours before harvest. SK-N-BE(2)c cells were treated with 200 μM 2,2′-dipyridyl (DIP), an iron chelator that promotes stabilization of HIF-α at normoxic conditions for 4 hours before harvest and were used as positive control for western blot detection of HIF-2α.

4.18 Oxygen sensing

Oxygen concentrations were measured through the trunk region of developing chick embryos ex ovo within 30 minutes from dissection using microsensors in a flow system of MQ water. We performed trials to confirm that oxygen concentrations are largely stable within the tissue ex ovo over at least 5 hours. Microprofiles were measured in 50 embryos in developmental stages HH10 to HH24. Embryos were removed from the egg using filter paper as described in Mohlin and Kerosuo, 24 submerged in a plate with constant flow of newly shaken MQ of room temperature, and immediately measured. Oxygen microsensors were constructed and calibrated as described by Revsbech and Andersen, 47 mounted on a micromanipulator. The microsensor was manually probing the trunk region and data logged every second. Within the microprofile, 10 consecutive data points of the lowest oxygen concentrations were averaged and set as representing the trunk neural tube. A two-point calibration was performed using the newly shaken MQ (100% oxygen saturation) and by adding sodium dithionite to nonflowing MQ in the plate after measurements (0% oxygen saturation). Salinity of the tissue was determined using a conductivity meter (WTW 3110) and room temperature noted. The tissue is considered a liquid, where full oxygen saturation at 5‰ salinity and 25°C corresponds to 250 μm/L, 160 mmHg, or 21% atmospheric O2. Data were averaged for each HH stage including one measurement of the previous and subsequent HH stages. Replicates vary from 3 to 10 biologically independent data points. Data are presented as percent of maximum saturation in the solution of the specific temperature and salinity.

4.19 Quantifications

Embryonic development was quantified in two ways by determining the HH stage of embryos in ovo using head and tail morphology or by counting the number of somites of dissected embryos ex ovo. The number of embryos (n) for each group is denoted in respective figure legend. The fraction of proliferating EdU + cells was determined by quantifying the number of GFP + proliferating cells as well as RFP + construct targeted cells and dividing the number of double positive cells with the number of RFP + only cells. Premigratory and recently delaminated trunk neural crest cells were included (distinguished by the dotted line in figures). Quantification of migration was performed by calculating the area of detected HNK1 using the ImageJ software. The area of HNK1+ on the electroporated side of the embryos was normalized to that of the control side of the same embryo.

4.20 Statistical methods and data sets

One-way analysis of variance or two-sided student's unpaired t test was used for statistical analyses. For downstream analysis on the 97 DEGs where the software IPA was used, the statistical tests considered were P-value calculations using right-tailed Fisher exact test.


Introduction

In the early 20th century, after extensive studies of the ovine fetal circulation, Sir Joseph Barcroft (1872-1947) postulated that the environment in which the human fetus develops would be comparable to that likely endured by an adult on the summit of Mount Everest [1, 2]. He termed this intriguing hypothesis 'Everest in utero' and proposed that to survive the hypoxic uterine environ ment the fetus must develop elaborate physiological strategies comparable to those seen in climbers ascending the great Himalayan peaks.

In 2007, four climbers descending from the summit of Mount Everest (8,848 meters) took arterial blood gases from one another at 8,400 meters above sea level. Their mean arterial partial pressure of oxygen (PaO2) was 3.28 kPa (24.6 mm Hg) with a mean calculated arterial oxygen saturation (SaO2) of 54% while they rested without supplemental oxygen [3]. Among this group, one individual had a PaO2 of 2.55 kPa (19.1 mm Hg), the lowest PaO2 ever reported in an adult human. So how far removed from intrauterine life were these measurements, and do climbers exhibit, as does the fetus, physiological strategies that may benefit the similarly hypoxemic critically ill patient?


Nanoparticles for Targeting Intratumoral Hypoxia: Exploiting a Potential Weakness of Glioblastoma

Extensive hypoxic regions are the daunting hallmark of glioblastoma, as they host aggressive stem-like cells, hinder drug delivery and shield cancer cells from the effects of radiotherapy. Nanotechnology could address most of these issues, as it employs nanoparticles (NPs) carrying drugs that selectively accumulate and achieve controlled drug release in tumor tissues. Methods overcoming the stiff interstitium and scarce vascularity within hypoxic zones include the incorporation of collagenases to degrade the collagen-rich tumor extracellular matrix, the use of multistage systems that progressively reduce NP size or of NP-loaded cells that display inherent hypoxia-targeting abilities. The unfavorable hypoxia-induced low pH could be converted into a therapeutical advantage by pH-responsive NPs or multilayer NPs, while overexpressed markers of hypoxic cells could be specifically targeted for an enhanced preferential drug delivery. Finally, promising new gene therapeutics could also be incorporated into nanovehicles, which could lead to silencing of hypoxia-specific genes that are overexpressed in cancer cells. In this review, we highlight NPs which have shown promising results in targeting cancer hypoxia and we discuss their applicability in glioblastoma, as well as possible limitations. Novel research directions in this field are also considered.

This is a preview of subscription content, access via your institution.