Information

How was gene knock out done in pre CRISPR era?

How was gene knock out done in pre CRISPR era?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I am trying to understand how CRISPR has made the gene knockout or gene editing process simpler to make transgenic animals. Here is an old (pre CRISPR) flowchart from Manis, 2007 that shows how knockouts can be made.

I assume much of this process remains the same even with CRISPR. But I want to understand what part of this flowchart has become easier with CRISPR? Is it that we do not need to wait for a random recombination event to occur? Is it that the yield has increased because we directly cut at the site and ask for HDR to happen rather than just sit and wait for it to happen?


CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells

Multiple Myeloma (MM) is a heterogeneous, hematological neoplasm that accounts 2% of all cancers. Although, autologous stem cell transplantation and chemotherapy are currently the most effective therapy, it carries a notable hazards, in addition for being non curative. Recently, the Clustered Regular Interspaced Short Palindromic Repeats (CRISPR-cas9) has been successfully tried at the experimental level, for the treatment of several hematological malignancies.

Objectives

We aimed to investigate the in-vitro effect of CRISPR-cas9-mediated knock-out of V-set pre B-cell surrogate light chain 1”VPREB1” gene on the malignant proliferation of primary cultured myeloma cells.

Methods

Bioinformatics’ analysis was performed to explore the gene expression profile of MM, and the VPREB1 gene was selected as a target gene for this study. We knocked-out the VPREB1 gene in primary cultured myeloma cells using CRISPR-cas9, the VPREB1 gene editing efficacy was verified by determining VPREB1 gene expression at both the mRNA and protein levels by qPCR and immunofluorescence, respectively. Furthermore, the cytotoxic effect on primary myeloma cells proliferation was evaluated using cytotoxicity assay.

Results

There was a statistically significant reduction of both VPREB1 mRNA and protein expression levels (p<0.01). knock-out of VPREB1 gene in myeloma cell line resulted in a statistically significant reduction of myeloma cell proliferation.

Conclusion

CRISPR-cas9-mediated knock-out of VPREB1 gene is effective for inhibiting the proliferation of primary myeloma cells. This would provide a basis for a promising therapeutic strategy for patients with multiple myeloma.

Citation: Khaled M, Moustafa AS, El-Khazragy N, Ahmed MI, Abd Elkhalek MA, El_Salahy EM (2021) CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells. PLoS ONE 16(1): e0245349. https://doi.org/10.1371/journal.pone.0245349

Editor: Zhi-Yao He, West China Hospital, Sichuan University, CHINA

Received: June 20, 2020 Accepted: December 22, 2020 Published: January 8, 2021

Copyright: © 2021 Khaled et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: The author(s) received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.


How was gene knock out done in pre CRISPR era? - Biology

Our promise to you:
Guaranteed product quality, expert customer support.

Gene Knockout Cell Line Generation

As one of leading providers in genome editing, CRISPR/Cas9 Platform CB brings customers the most comprehensive gene knockout service. We are focusing on CRISPR technology development to serve customer with satisfied products and service. In terms of leading-edge platform, experienced scientists and skilled staff, we have succeeded in generating gene knockout cell line in multiple species, such as human cells, mouse cells, rat cells and monkey cells.

Gene is a DNA or RNA sequence that codes for a molecule that has a function. A chromosome consists of a long strand of DNA containing many genes. For example, a human chromosome can have up to 500 million base pairs of DNA with thousands of genes. In genetic study, gene knockout or overexpression are widely applied for function study. Since the development of CRISPR system, it becomes easier to get a gene knockout cell line or model for further research. Using CRISPR/Cas9 for gene knockout, an indel is introduced to the target loci that results in a frame shift mutation. When applied for gene knockout, sgRNA is designed to target the exons of gene. Then Cas9 will be recruited to the specific loci and induce DSB. Indels occur when repairing DNA double strand break in error-prone way.

CRISPR/Cas9 Platform CB offers a gene knockout service for various cell lines, including easy-to-handle cells, tumor cells, stem cells and difficult-to-handle cells. Given that the unique of every case, we will provide a free consultation at the beginning. After submitting the information of gene and cell line, we will make a plan to assist you for your goals.


FDA approves first test of CRISPR to correct genetic defect causing sickle cell disease

Sickle cell patients such as Cassandra Trimnell and Evie James Junior and UCSF physician Mark Walters talk about the severe pain experienced by those with the disease and the potential benefits of a CRISPR cure.

In 2014, two years after her Nobel Prize-winning invention of CRISPR-Cas9 genome editing, Jennifer Doudna thought the technology was mature enough to tackle a cure for a devastating hereditary disorder, sickle cell disease, that afflicts millions of people around the world, most of them of African descent. Some 100,000 Black people in the U.S. are afflicted with the disease.

Mobilizing colleagues in the then-new Innovative Genome Institute (IGI) — a joint research collaboration between the University of California, Berkeley, and UC San Francisco — they sought to repair the single mutation that makes red blood cells warp and clog arteries, causing excruciating pain and often death. Available treatments today typically involve regular transfusions, though bone marrow transplants can cure those who can find a matched donor.

After six years of work, that experimental treatment has now been approved for clinical trials by the U.S. Food and Drug Administration, enabling the first tests in humans of a CRISPR-based therapy to directly correct the mutation in the beta-globin gene responsible for sickle cell disease. Beta-globin is one of the proteins in the hemoglobin complex responsible for carrying oxygen throughout the body.

The trials, which are expected to take four years, will be led by physicians at UCSF Benioff Children’s Hospital Oakland and UCLA’s Broad Stem Cell Research Center who plan to begin this summer to enroll six adults and three adolescents with severe sickle cell disease.

The IGI’s clinical diagnostics laboratory, which was built under Doudna’s leadership to provide free COVID-19 testing to the Berkeley community, will play a key role in analytical support for the trial by developing diagnostics to monitor patient well-being and track the efficiency of the treatment.

“We are motivated to work toward a cure that can be accessible and affordable to patients worldwide,” said Doudna, UC Berkeley professor of molecular and cell biology and of chemistry and a Howard Hughes Medical Institute investigator. “The launch of this trial is an essential first step on that path.”

Dr. Mark Walters, a professor of pediatrics at UCSF and the Jordan Family Director of the Blood and Marrow Transplantation Program at UCSF Benioff Children’s Hospital Oakland, is leading the clinical trial.
Credit: UCSF

Other trials have successfully used CRISPR-Cas9 to knock out a gene that suppresses the fetal hemoglobin gene, which is normally turned off in humans. That technique reawakens the fetal gene and, in at least three patients, has alleviated symptoms of sickle cell disease.

The new trial is a gene knock-in: The researchers are using CRISPR-Cas9 to replace the defective beta-globin gene with a repaired version, with the goal of creating normal, adult red blood cells and curing the disorder.

“This therapy has the potential to transform sickle cell disease care by producing an accessible, curative treatment that is safer than the current therapy of stem cell transplant from a bone marrow donor,” said Dr. Mark Walters, a professor of pediatrics at UCSF and principal investigator of the clinical trial and gene editing project. “If this is successfully applied in young patients, it has the potential to prevent irreversible complications of the disease.”

Patients are their own stem cell donor

The technique, as with the alternate approach that reawakens fetal hemoglobin, requires that some of the patient’s hematopoietic stem cells — the bone marrow cells that generate all the body’s red blood cells — be harvested for gene editing outside the body. After these cells are removed, the remaining bone marrow is destroyed with chemotherapy to allow space for the repaired and reinfused stem cells to grow.

Dr. Donald Kohn, a distinguished professor of microbiology, immunology and molecular genetics, pediatrics and molecular and medical pharmacology at the David Geffen School of Medicine at UCLA and a member of the UCLA Broad Stem Cell Research Center, is involved in various gene therapy trials for diseases such as SCID and sickle cell disease.
Credit: UCLA

Walters, who is also the Jordan Family Director of the Blood and Marrow Transplantation Program at UCSF Benioff Children’s Hospital Oakland, will be working with UCLA physician-scientist Dr. Donald Kohn, who has developed gene therapies for several genetic blood disorders, including a cure for a form of severe combined immunodeficiency (SCID). Kohn is also leading a clinical trial of a different type of gene therapy for sickle cell disease, which involves adding a new gene to patients’ stem cells to overcome the sickle cell mutation.

“Gene therapy and gene editing allow each patient to serve as their own stem cell donor,” said Kohn, a distinguished professor of microbiology, immunology and molecular genetics, pediatrics, and molecular and medical pharmacology at the David Geffen School of Medicine at UCLA and a member of the UCLA Broad Stem Cell Research Center. “In theory, these approaches should be much safer than a transplant from another person and could become universally available because they eliminate the need to find the needle in a haystack that is a matched stem cell donor.”

Kohn will lead the laboratory and clinical trial activities at UCLA and oversee all manufacturing of the drug product, called CRISPR_SCD001, for the clinical trial. The preclinical work to develop this therapy was funded by the California Institute for Regenerative Medicine the National Heart, Lung, and Blood Institute-led Cure Sickle Cell Initiative and the Doris Duke Charitable Foundation.

Fyodor Urnov, IGI director of technology and translation and a UC Berkeley professor of molecular and cell biology, will oversee the bioinformatics and genomics activities for the study.

“It is noteworthy that this new trial comes from a consortium of not-for-profit academic institutions incentivized with a long-term vision to cure the disease with an affordable solution that can globally benefit everyone who needs it,” Urnov said.

Fyodor Urnov, IGI’s scientific director of technology and translation, has led the basic research on CRISPR therapies for sickle cell disease.
Credit: Keegan Houser

Sickle cell disease is caused by a single change in the DNA code of the beta-globin gene. The new trial uses the CRISPR-Cas9 nuclease — a fully assembled Cas9 protein and guide RNA sequence targeting the defective region of the beta-globin gene, accompanied by a short DNA segment encoding the proper sequence — to stimulate repair of the sickle mutation by substituting the normal DNA segment for the abnormal one. In this approach, the patient’s blood stem cells are first treated with electrical pulses that create pores in their membranes. These pores allow the CRISPR-Cas9 platform to enter the stem cells and travel to their nuclei to correct the sickle cell mutation.

“The goal of this form of genome-editing therapy is to correct the mutation in enough stem cells so the resulting blood in circulation has corrected red blood cells,” Walters said. “Based on our experience with bone marrow transplants, we predict that correcting 20% of the genes should be sufficient to out-compete the native sickle cells and have a strong clinical benefit.”

The final manufacturing protocol uses a virus-free method to edit blood stem cells and has been validated in pre-clinical safety/toxicology studies performed after consultation with the FDA.

Future CRISPR therapies

While UC physicians take the current CRISPR therapy into clinical trials, IGI scientists are working to improve the technique so that, eventually, the correction of the sickle cell mutation can be done inside the body, without removing stem cells or destroying the bone marrow. Because the bone marrow also produces white blood cells that protect us from disease, destroying it dampens the immune system and puts patients at increased risk of infection or even cancer until the infused, corrected stem cells can multiply and replenish.

Sickle cell disease is caused by a mutation in the beta-globin gene that makes red blood cells warp into a sickle shape (foreground) as compared to the normal circular shape seen in the background. The sickled cells clog arteries, leading to intense pain and organ damage.
Credit: Innovative Genomics Institute, UC Berkeley

“Currently, we are doing ex vivo therapy, where you take cells out of the bone marrow to correct the mutation outside the body,” said Ross Wilson, IGI’s director of therapeutic delivery. “But during this time — it could be months — the bone marrow is filling back up. As a result, when it’s time to infuse the corrected cells, the patient must be subjected to aggressive chemotherapy that clears out the bone marrow and allows those corrected cells to find a home.”

Wilson is optimistic that he and IGI scientists can find a way to send the CRISPR therapy directly to the bone marrow inside the body, using antibodies to target the CRISPR enzyme to the correct stem cells. Other scientists, who use engineered viruses or fatty droplets — lipid nanoparticles — to ferry the CRISPR enzyme into the body, have so far failed.

“The molecule we are trying to deliver is physically smaller — an eighth the diameter of the nanoparticles other people try to deliver to the bone marrow — and this could provide big benefits,” he said. “Our self-delivering enzyme should be able to reach the bone marrow.”

Graphic representation of CRISPR-Cas9 repairing the mutation in the gene that causes sickle cell disease (shown in light blue).
Credit: UC Berkeley image courtesy of Innovative Genomics Institute

Whatever the successful strategy, either ex vivo or in vivo, the CRISPR platform developed for sickle cell disease could transform gene therapy for other diseases.

“That is the IGI vision: first sickle cell, but our efforts will have a ripple effect to enable cures for blood disorders in general, like beta thalassemia, as well as diseases of the immune system,” he said. “The hematopoietic stem cell is the seed for the entire immune system, so all blood disorders can theoretically be cured by a stem cell therapy like this.”


Genome Editing B.C. (Before CRISPR)

Genome editing with engineered nucleases, a powerful tool for understanding biological function and revealing causality, was built in a joint effort by academia and industry in 1994–2010. Use of CRISPR/Cas9 is the most recent (2013–), and facile, implementation of the resulting editing toolbox. Principles and methods of genome editing from the pre-CRISPR era remain relevant and continue to be useful.

In the beginning…

…was the double-strand break (DSB). Induced at a specific position of a mammalian chromosome by Maria Jasin in 1994 (19 B.C. [before CRISPR * ]), 1 it set in motion a chain of events, including landmark studies by Dana Carroll (2000–2003 13–10 B.C.), 2–4 that brought us all directly, in 2018, to genome-edited potatoes, 5 and people, 6 and a Noah's ark of edited cells and organisms.

As a result, biomedical scientists now have a powerful remedy for a formerly crippling epistemological problem (Figure 1): in the absence of information, the human mind fills in the gaps with things it simply makes up. Genome editing is a tool to get away from these “just so stories” and closer to biological reality. It is also the definitive tool for the determination of causality.

The toolbox of editing was developed between 1994 and 2010 in a joint effort between academia and industry, using meganucleases for proof-of-concept 7 and zinc finger nucleases (ZFNs) for editing of native loci. 8 In 2010–2012, the toolbox was rapidly ported, wholesale, to a third nuclease class—one based on the TAL effector domain. 9

The history of industrial progress has several examples of a “1 + 1 = 7” effect from the convergence of previously unconnected lines of effort. Aluminum, discovered in 1825 and purified at scale in 1886, found its widespread use with the invention of the airplane and the rise of aviation in the 1910s. The Corning Company developed “gorilla glass” in the 1960s for potential use in automobile and plane windshields it became ubiquitous as the surface of the iPhone a half-century later.

In 1987–1989, an “unusual arrangement with repeated sequences” was observed at a specific locus in the Escherichia coligenome—an arrangement now known as a “clustered regularly interspaced short palindromic repeat,” or CRISPR. 10 ,11 This launched a quarter-century of studies not in genome engineering, but in bacterial immunity centered on such CRISPR loci. 12 ,13 As described below, this work ultimately led to the discovery, in 2012, that a key enzyme of a specific CRISPR-based system, Cas9, is an RNA-guided endonuclease. 14 This discovery resonated in a special way, one unrelated to bacterial immunity, because of the decade-long precedent of genome editing with ZFNs and, more recently, TAL effector nucleases (TALENs). Thus, in 2012, Martin Jinek, Jennifer Doudna, Emmanuelle Charpentier, and colleagues wrote: “Zinc-finger nucleases and transcription-activator–like effector nucleases have attracted considerable interest as artificial enzymes engineered to manipulate genomes. We propose an alternative methodology based on RNA-programmed Cas9 that could offer considerable potential for gene-targeting and genome-editing applications.” 14 A short time later, Gasiunas et al. wrote: “Taken together, these findings pave the way for the development of unique molecular tools for RNA-directed DNA surgery.” 15 In January 2013, publications from four laboratories—those of George Church, Doudna, Jin-Soo Kim, and Feng Zhang—presented data reducing this suggestion to practice. 16–19

The brief history of CRISPR-Cas9 gene editing has already received considerable analysis. Here, I aim to discuss the findings from the approximately 18-year-long effort on building genome editing that preceded the Age of CRISPR (Figure 2). It focuses on principles and methods that remain relevant and useful to genome editors today.


Figure. 2. A timeline of edited cells, organisms, editing outcomes, and nucleases from the “B.C” age. The organisms, left to right, are: budding yeast and mice (gene targeting) tissue culture cells Xenopus oocytes Drosophila melanogaster human tissue culture cells zebrafish maize rat mouse silk moth C. elegans, Xenopus tropicalis, rabbit, pig rice. 2–4,22–24,42,66–69,73,74,115–119 This is a representative list that aims to showcase the taxonomic breadth of editing a comprehensive list of organisms genome-edited in the pre-B.C. age can be found in Table 2 of Ref. 9. Artwork: (Tanya Sheremeta and Rae Senarighi nuclease structures courtesy of J. Keith Joung.

Genetic Engineering Before Editing: Of Mice and Yeast

Between the invention of recombinant DNA 20 and DNA sequencing 21 in the 1970s, and until the toolbox of editing was essentially complete by 2010, 8 targeted genetic engineering was the province of a select few model organisms, progress in the study of which was much faster than in other, genetically intractable, systems.

Gene targeting is born. Gerry Fink's and Ron Davis's laboratories showed 22 ,23 that a yeast gene can be replaced with a selectable marker and thus knocked out. For example, the Davis lab transformed yeast cells with a plasmid in which the marker (URA3) is flanked by regions of homology to the gene of interest (HIS3). Selection for marker-positive cells shows that URA3-positive cells carry the marker at HIS3. This method became a key source of the “awesome power of yeast genetics,” and over the subsequent three decades, the yeast research community uses it, among other things, to make a collection of null and hypomorphic alleles across the entire yeast genome, widely used for reverse genetic screens.

Gene targeting works in mouse embryonic stem (ES) cells. Inspired by the precedent from yeast, Mario Capecchi showed 24 that a gene that can be selected against in mouse ES cells (HPRT) can be knocked out by targeting to it a different gene—a marker that can be selected for (neo r ). In 1992, Michael Rudnicki and Rudolf Jaenisch discover, 25 in the course of efforts to knock out genes that cannot be selected for, that long stretches of isogenic DNA are required for efficient targeting. Many elegant technical improvements are invented by the mouse research community, and, just as in yeast, classical gene targeting (the use of selection to transfer one gene to another) becomes the basis for comprehensive collections of knockout mouse ES cells, and mice genetically engineered in sophisticated ways. Use of classical gene targeting in settings other than mouse ES cells remains, to this day, an experimental challenge (see below).

Gene targeting can work in settings other than mouse ES cells. John Sedivy, among others, uses “gene targeting vectors” to knock out cell-cycle-control related genes in primary human fibroblasts. 26 The results are thought-provoking, which makes the technical challenges associated with gene targeting an unfortunate feature of the state of the field at the time.

Gene targeting can be improved via the use of adeno-associated virus (AAV) vectors. David Russell makes the important discovery 27 that if one uses AAV to deliver the “gene targeting construct,” its efficiencies improve. Bert Vogelstein, in 2004, expands this observation to show 28 that in HCT116 cells, use of AAV-based gene targeting produces, after selection, 13 out of 244 drug-resistant clones that have one allele of a representative gene (CCR5) knocked out.

Gene targeting made yeast and mice into the dominant genetic systems used between 1980 and 2012. By 2005, however, after 11 years of effort (see below), genome engineers had found not merely a “better mousetrap.” They found a cat: a fundamentally new way to alter the genome, one that requires neither targeting vectors nor selection, one that can generate any allele in a single step, and one that works in organisms as well as in cells. That “cat,” of course, is genome editing. As will be seen below, its current utility and ubiquity derives from a thoughtful collaboration with Mother Nature, specifically, with the equally ubiquitous process of DSB repair.

Lasting Lessons from the B.C. Age

18 B.C. (1994): a DSB is editogenic in mammalian cells

This was the first key discovery of the Age of Editing. Maria Jasin found that a single DSB delivered by an enzyme to a mammalian chromosome in mitotically dividing cells is efficiently repaired either by homology-directed repair (HDR) from an investigator-provided template, or by nonhomologous end joining (NHEJ). 1

To appreciate this finding, some context. In 1982, Jeffrey Strathern et al. discovered that a DSB initiates the transfer of genetic information during mating type switching in budding yeast, 29 and over the subsequent decades, a wealth of knowledge about the role of DSBs in genetic exchange is obtained, notably by Jim Haber, 30 from studying this system. 31 In 1983, Jack Szostak, Terry Orr-Weaver, Rodney Rothstein, and Franklin Stahl proposed that a DSB is the initiating event in meiotic recombination. 32 By the late 1980s, dogma in the field of DNA repair held that end joining, rather than HDR, is the dominant DSB pathway in mitotically dividing mammalian cells in culture (this was in part based on low efficiencies of classical gene targeting).

Jasin's interest in this problem began when she was a postdoctoral fellow with Paul Berg in the late 1980s. She started her laboratory at Memorial Sloan Kettering in 1990, where she reasoned (see Supplementary Data Box 1 “The Book of Jasin” Supplementary Data are available online at www.liebertpub.com/crispr) that this problem could be resolved using a nuclease that (1) would induce a single DSB in the chromosome of a mammalian cell and (2) would be tolerated by that cell. In the first of several remarkable “leaps across species” from which the field of genome editing has benefitted, she repurposed an enzyme discovered in 1985 by Bernard Dujon: a nuclease, I-SceI, that evolved to function inside yeast mitochondria to cut an 18 base pairs (bp) target site and thereby spread its own open reading frame. 33 The experiment made use of a chromosomal reporter gene in which a selectable marker was interrupted by the recognition site of I-SceI, and thus selection could be used to track down rare cells of interest. Cells transfected with a 700 bp fragment carrying the wild-type marker sequence produced no wild-type progeny. Co-delivering the DSB-inducing nuclease produced a wealth of these, however, and an analysis of their DNA sequences showed they have resulted from HDR-based replacement of the nuclease target site with wild-type DNA. Delivering the nuclease alone also produced wild-type cells, with sequence analysis showing they resulted from a microhomology-driven, end joining–based elimination of the nuclease site from the reporter gene. From one experiment with a reporter construct thus came three conclusions that resonate to this day: (1) in mitotically dividing mammalian cells in culture, a nuclease-induced DSB enhances—from undetectable to readily revealed by selection—the HDR-based transfer of genetic information into the chromosome from an ectopic fragment (2) NHEJ is a competing pathway for repair of this DSB, which produces small insertions and deletions (indels) at the nuclease target and (3) expression of such a nuclease is tolerated by mammalian cells.

Horace Judson's incomparable history of molecular biology, The Eighth Day of Creation, recounts the moment when Francis Crick came to the lab where Leslie Barnett had just obtained the results from the legendary “uncles and aunts” experiment that asked how many base pairs form each “letter” of the genetic code. 34 Crick looked at the plates with the phage plaques, then looked at Barnett and said, “You and I are the only two people on Earth who know that the genetic code is a triplet.” Philippe Rouet, Fatima Smih, and Jasin, in examining the indels and precisely repaired chromosomes induced by I-SceI, were at that moment in 1993 or early 1994 in that rare category of scientists: unique in their knowledge of a fundamentally important truth.

13–10 B.C. (2000–2003): an enzyme can be engineered to induce a DSB and drive editing at a locus of interest in eukaryotic cells

This was the second key discovery of the Age of Editing. Aware of the implications of the Jasin results (targeted DSB = editing!) and of challenges regarding reengineering of meganucleases for genes of interest, Dana Carroll set his sights on a recently invented engineering restriction enzyme: the ZFN (a fusion between a zinc finger–based DNA binding domain and the cleavage domain from a restriction enzyme, FokI). ZFNs were originally built, at the suggestion of Hamilton Smith, by the Chandrasegaran laboratory, for use as novel restriction enzymes. 35 In a telling example of how hard it is to predict the path of technology development, these engineered enzymes found their true calling in a setting completely unrelated to what they were invented for.

Dana Carroll trained with Don Brown and, in starting his own research laboratory at the University of Utah, was well aware of the unique power of the Xenopus oocyte as a model system: it allows the rapid in-cell evaluation of the action of a large number of DNA-binding proteins on any number of engineered templates. 36 Further, zinc fingers were discovered by Aaron Klug in Xenopus, 37 and while they represent the dominant class of DNA-binding domains across all metazoa, 38 if there was one species where a zinc finger–based new enzyme had a chance, it was Xenopus. Carroll used this system for all its might, identifying the biochemical parameters that govern efficient target recognition, cutting, and recombination on a plasmid template by ZFNs in the oocyte. 2 The stage was now set (see Supplementary Data Box 1: “The Book of Carroll”) for editing a gene.


Materials and Methods

Plasmid construction

pEntry-sgRNA was generated by Mutagenex (530 Highland Station Dr., Suwanee, GA) as follows. U6-sgRNA fragment from pU6-(BbsI)_Cbh-Cas9-T2A-mCherry plasmid (Addgene #64324 46 ) was PCR-amplified with primers with attL1 and attL2 sequence and subcloned into pEAR A1A (Supplementary Fig. 9).

pShuttle-Cas9-DEST plasmid was constructed by two steps of subcloning. First, Cbh-Cas9-T2A-mCherry-polyA fragment from the pU6-(BbsI)_Cbh-Cas9-T2A-mCherry plasmid (Addgene #64324) was subcloned into XbaI and NotI sites of pShuttle (Addgene #16402 21 ). Then, R1-Cm R -ccdB-R2 fragment from the Gateway pDEST (ThermoFisher Scientific, Hampton, NH) was subcloned into the intermediate vector (Supplementary Fig. 10).

pAdTrack-Cas9-Dest was constructed by subcloning Cbh-Cas9 and polyA fragments from the pU6-(BbsI)_Cbh-Cas9-T2A-mCherry plasmid (Addgene #64324), and R1-Cm R -ccdB-R2 fragment from the Gateway pDEST into KpnI/HidIII, HindIII and KpnI sites of pAdTrack (Addgene #16404 21 ), respectively (Supplementary Fig. 11).

Generation of pEntry-sgRNA amplicons by two step PCR and LR cloning

The first round of PCR was performed using two sets of primers as described in Table 1. The second round of PCR was performed using a mixture of two PCR products (1 ul each of 100-fold diluted PCR product) as templates and L1 + L2 primers (Table 1). The same thermal cycling conditions were used. Note that extra c and g (lower case) were appended to U6-Rev and Scaff-fwd primers to allow the sgRNA to start with “G” if the target seq does not start with “G” as recommended by Ran et al. 4 The final PCR products were purified and mixed with either pShuttle-Cas9-DEST or pAdTrack-Cas9-DEST along with LR clonase (Thermo Fisher Scientific #11791020) to generate final all-in-one vectors. Bacterial colonies transformed with the reaction mixture were screened by colony PCR that amplifies DNA region flanked by R1 and R2 (negative clones), or B1 and B2 (positive recombinants). Two different sets of primers were used for pShuttle and pAdTrack as follows.

attR1 Up Fwd: 5′-GAGCCCACTGCTTACTGGCTTATC-3′

Cbh Rev: 5′-CGTACTTGGCATATGATACACTTGA-3′

Size of PCR amplicons: 1,966 bp negative clone and 691 bp for positive recombinant.

Size of PCR amplicons: 1820 bp for negative clone and 545 bp for positive recombinant.

Transfection and T7E1 assay

A U2OS cell line expressing luciferase under a Bmal1 promoter was described previously. For transfection with the all-in-one plasmids, cells were plated into 6 cm dishes to be approximately 60% confluent on the day of transfection. Cells were transfected with Polyfect (Qiagen, Hilden, Germany) according to the manufacturer’s protocol and incubated for 2 days before they were subjected to trypsinization and FACS sorting using BD FACSAria SORP equipped with an Automated Cell Deposition Unit (ACDU) for sorting into 96 well plates. Cells were trypsinized with Trypsin (0.25%)-EDTA (2.21 mM) for 3 min and were filtered through mesh with 50um pores. FACS-sorted cells were collected into three groups: negative, intermediate and bright mCherry, and plated into 35 mm dishes and grown for 2 days before harvest and genomic DNA extraction. Before the cells were harvested, they were inspected for mCherry expression. Even the bright mCherry group included 10–30% of non-mCherry cells. Harvested cell pellets were homogenized in 250 ul solution A containing 0.1 M Tris-HCl pH = 9.0, 0.1 M EDTA, and 1% SDS, and incubated at 70 °C for 30 minutes. 35 ul 8 M potassium acetate was added and incubated at room temperature for 5 minutes. The samples were centrifuged at 13,000 rpm for 15 minutes and genomic DNA was purified by subjecting the supernatant to phenol-chloroform extraction and ethanol precipitation. The extracted genomic DNA pellet was dissolved in 100 ul water and used as a template to PCR amplify the target genomic locus with a set of primers (Table 2) flanking the target region. Amplicons were confirmed by agarose electrophoresis, and purified with PCR purification kit (QIAGEN Cat.28104). 200 ng DNA samples were denatured and annealed according to the protocol in Ran et al. and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.

TOPO-PCR cloning and sequencing

PCR amplicons obtained above were cloned into plasmids using the TOPO-PCR cloning kit (Invitrogen #K2800), and inserts were sequenced from 20 colonies each for Bmal1 exon 7 and Per2 exon 15. Wt contamination was confirmed: 4 out of 16 were wt for Bmal1 exon 6 and 2 out of 15 were wt for Per2.

Single cell isolation and expansion, bioluminescence monitoring and immunoblotting

mCherry-expressing cells were singly sorted into 96 well plates by FACS and expanded serially into 24 well plates, 6 well plates, and then 10 cm dishes. A few dozen clones for each of Bmal1 exon 6, 8 and 9, and Per2 exon 5 were set up for bioluminescence monitoring as described previously 19 . For immunoblotting for BMAL1, a previously described anti-BMAL1 antibody (GP3) was used 47 . For human PER2, novel polyclonal anti human PER2 antibodies were generated in guinea pigs using aa 1–200 peptide by Cocalico Biologicals, Inc (449 Stevens Rd, Reamstown, PA). hP2-GP49 was used in the current study. The antibody was validated by oscillations of human PER2 in U2OS cells and a novel monoclonal antibody against human PER2 (hP2-C6A3). The monoclonal antibody was selected from clones of antibodies raised against aa 1–200 of human PER2 by Boreda Biotech (Seongnam, Gyeonggi-Do, Korea). The monoclonal antibody was also able to detect oscillations of PERs in U2OS cells similarly (Supplementary Fig. 7). Uncropped immunoblot images are shown in Supplementary Fig. 12.

Generation of adenovirus

Adenoviruses expressing mutant BMAL1 lacking the DNA-binding domain or wt BMAL1 were described previously 19,38 . To generate adenovirus expressing Cas9 and sgRNA targeting Bmal1 exon 6, pAdTrack-Cas9-U6-Bmal1E6 sgRNA plasmid was used to transform electrocompetent BJ5183 cells harboring pAdEasy1 by electroporation. Positive recombinants were selected by PacI digestion and transfected into the packaging cell line 293A in a T25 flask. Cells were harvested along with the medium 10–12 days later. Adenovirus was released from the cells by freezing and thawing cells + medium three times and harvested by centrifugation. The supernatant was used to infect confluent 293 cells in two T75 flasks. Final adenoviral prep was obtained by 3 cycles of freezing-thawing cell + medium from two T75 flasks and centrifugation. The final lysate contains

3 × 10 7 transducing units (TU). When compared with 293 cells, expression forming units (efu) of the adenovirus was 5–10 fold lower for U2OS cells. However, U2OS cells could be infected with

100% efficiency without further purification, unlike infection for MEFs 19 . To ensure 100% infection in U2OS cells with the all-in-one adenovirus, the cells were infected at MOI of 50 twice, two days apart.


Biological Intervention of CRISPR/Cas9 in Clinical Trials

Cancer Immunotherapy

The first CRISPR Phase 1 clinical trial in the US opened in 2018 with the intent to use CRISPR/Cas9 to edit autologous T cells for cancer immunotherapy against several cancers with relapsed tumors and no further curative treatment options. These include multiple myeloma, melanoma, synovial sarcoma and myxoid/round cell liposarcoma. This trial was approved by the United States Food and Drug Administration (FDA) after careful consideration of the risk to benefit ratios of this first application of CRISPR gene therapy into the clinic. During this trial, T lymphocytes were collected from the patients' blood and ex vivo engineered with CRISPR/Cas9 to knockout the α and β chains of the endogenous T cell receptor (TCR), which recognizes a specific antigen to mediate an immune response, and the programmed cell death-1 (PD-1) protein, which attenuates immune response. The cells were then transduced with lentivirus to deliver a gene encoding a TCR specific for a NY-ESO-1 antigen, which has been shown to be highly upregulated in the relapsed tumors and thus can serve as a therapeutic target. Since then, many trials have opened for CRISPR-mediated cancer immunotherapy and is currently the most employed strategy for CRISPR gene therapy ( Table 2 ). A trial implementing this strategy using other tools had already been conducted in both pre-clinical and clinical settings, but this was the first time CRISPR/Cas9 was used to generate the genetically modified T cells (97). The moderate transition of switching only the tool used for an already approved therapeutic strategy may have been key to paving the road for using CRISPR's novel abilities for gene manipulation, such as targeted gene disruption.

Table 2

Biological intervention of CRISPR gene therapy in clinical trials.

Sponsor/affiliationDiseaseGene targetClinial Trial IDCRISPR-Cas9 mediated intervention
University of Pennsylvania/Parker Institute for Cancer Immunotherapy/TmunityMultiple Myeloma, Melanoma, Synovial Sarcoma, Myxoid/Round Cell LiposarcomaTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03399448","term_id":"NCT03399448">> NCT03399448NY-ESO-1 redirected autologous T cells with CRISPR edited endogenous TCR and PD-1
Affiliated Hospital to Academy of Military Medical Sciences/Peking University/Capital Medical UniversityHIV-1CCR5 <"type":"clinical-trial","attrs":<"text":"NCT03164135","term_id":"NCT03164135">> NCT03164135CD34+ hematopoietic stem/progenitor cells from donor are treated with CRISPR/Cas9 targeting CCR5 gene
CRISPR Therapeutics AGMultiple MyelomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT04244656","term_id":"NCT04244656">> NCT04244656CTX120 B-cell maturation antigen (BCMA)-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified ex vivo using CRISPR-Cas9 gene editing components
Crispr Therapeutics/VertexBeta-Thalassemia, Thalassemia, Genetic Diseases Inborn, Hematologic Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03655678","term_id":"NCT03655678">> NCT03655678CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Crispr TherapeuticsB-cell MalignancyNon-Hodgkin LymphomaB-cell LymphomaTCRα, TCRβ <"type":"clinical-trial","attrs":<"text":"NCT04035434","term_id":"NCT04035434">> NCT04035434CTX110 (CD19-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified ex vivo using CRISPR-Cas9 gene editing components)
Editas Medicine, Inc./AllerganLeber Congenital Amaurosis 10CEP290 <"type":"clinical-trial","attrs":<"text":"NCT03872479","term_id":"NCT03872479">> NCT03872479Single escalating doses of AGN-151587 (EDIT-101) administered via subretinal injection
Vertex Pharmaceuticals Incorporated/CRISPR TherapeuticsSickle Cell Disease, Hematological Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Allife Medical Science and Technology Co., Ltd.ThalassemiaHBB <"type":"clinical-trial","attrs":<"text":"NCT03728322","term_id":"NCT03728322">> NCT03728322Investigate the safety and efficacy of the gene correction of HBB in patient-specific iHSCs using CRISPR/Cas9
Yang Yang, The Affiliated Nanjing Drum Tower Hospital of Nanjing University Medical SchoolStage IV Gastric Carcinoma, Stage IV Nasopharyngeal Carcinoma, T-Cell Lymphoma Stage IV, Stage IV Adult Hodgkin Lymphoma, Stage IV Diffuse Large B-Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03044743","term_id":"NCT03044743">> NCT03044743CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
First Affiliated Hospital, Sun Yat-Sen University/Jingchu University of TechnologyHuman Papillomavirus-Related Malignant NeoplasmHPV16 and HPV18 E6/E7 DNA <"type":"clinical-trial","attrs":<"text":"NCT03057912","term_id":"NCT03057912">> NCT03057912Evaluate the safety and efficacy of TALEN-HPV E6/E7 and CRISPR/Cas9-HPV E6/E7 in treating HPV Persistency and HPV-related Cervical Intraepithelial NeoplasiaI
Sichuan University/Chengdu MedGenCell, Co., Ltd.Metastatic Non-small Cell Lung CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02793856","term_id":"NCT02793856">> NCT02793856CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityMetastatic Renal Cell CarcinomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867332","term_id":"NCT02867332">> NCT02867332CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityHormone Refractory Prostate CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867345","term_id":"NCT02867345">> NCT02867345CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityInvasive Bladder Cancer Stage IVPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02863913","term_id":"NCT02863913">> NCT02863913CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Hangzhou Cancer Hospital/Anhui Kedgene Biotechnology Co., LtdEsophageal CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03081715","term_id":"NCT03081715">> NCT03081715CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Chinese PLA General HospitalSolid Tumor, AdultTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03545815","term_id":"NCT03545815">> NCT03545815Evaluate the feasibility and safety of CRISPR-Cas9 mediated PD-1 and TCR gene-knocked out chimeric antigen receptor (CAR) T cells in patients with mesothelin positive multiple solid tumors
Baylor College of Medicine/The Methodist Hospital SystemT-cell Acute Lymphoblastic Leukemia, T-cell Acute Lymphoblastic Lymphoma, T-non-Hodgkin LymphomaCD7 <"type":"clinical-trial","attrs":<"text":"NCT03690011","term_id":"NCT03690011">> NCT03690011CRISPR-Cas9 mediated CD7 knockout-T cells from autologous origin
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03398967","term_id":"NCT03398967">> NCT03398967Determine the safety of the allogenic CRISPR-Cas9 gene-edited dual specificity CD19 and CD20 or CD22 CAR-T cells
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT03166878","term_id":"NCT03166878">> NCT03166878CRISPR-Cas9 mediated TCR and B2M knockout-T cells from allogenic origin for CD19 CAR-T
Chinese PLA General HospitalSolid Tumor, AdultPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03747965","term_id":"NCT03747965">> NCT03747965CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Xijing Hospital/Xi'An Yufan Biotechnology Co., LtdLeukemia, LymphomaHPK1 <"type":"clinical-trial","attrs":<"text":"NCT04037566","term_id":"NCT04037566">> NCT04037566CRISPR Gene Edited to Eliminate Endogenous HPK1 (XYF19 CAR-T Cells)

Gene Disruption

The first clinical trial in the US using CRISPR to catalyze gene disruption for therapeutic benefit were for patients with sickle-cell anemia (SCD) and later β-thalassemia, by Vertex Pharmaceuticals and CRISPR Therapeutics. This therapy, named CTX001, increases fetal hemoglobin (HbF) levels, which can occupy one or two of four hemoglobin binding pockets on erythrocytes and thereby provides clinical benefit for major β-hemoglobin diseases such as SCD and β-thalassemia (103). The trial involved collecting autologous hematopoietic stem and progenitor cells from peripheral blood and using CRISPR/Cas9 to disrupt the intronic erythroid-specific enhancer for the BCL11A gene ( <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287) as disruption of this gene increases HbF expression (104�). Genetically modified hematopoietic stem cells with BCL11A disruption are delivered by IV infusion after myeloablative conditioning with busulfan to destroy unedited hematopoietic stem cells in the bone marrow. Preliminary findings from two patients receiving this treatment seem promising. One SCD patient was reported to have 46.6% HbF and 94.7% erythrocytes expressing HbF after 4 months of CTX001 transfusions and one β-thalassemia patient is expressing 10.1 g/dL HbF out of 11.9 g/dL total hemoglobin, and 99.8% erythrocytes expressing HbF after 9 months of the therapy. Results from the clinical trial that has opened for this therapy ( <"type":"clinical-trial","attrs":<"text":"NCT04208529","term_id":"NCT04208529">> NCT04208529) to assess the long-term risks and benefits of CTX001 will dictate whether this approach can provide a novel therapeutic opportunity for a disease that otherwise has limited treatment options.

In vivo CRISPR Gene Therapy

While the aforementioned trials rely on ex vivo editing and subsequent therapy with modified cells, in vivo approaches have been less extensively employed. An exciting step forward with CRISPR gene therapy has been recently launched with a clinical trial using in vivo delivery of CRISPR/Cas9 for the first time in patients. While in vivo editing has been largely limited by inadequate accessibility to the target tissue, a few organs, such as the eye, are accessible. Leber congenital amaurosis (LCA) is a debilitating monogenic disease that results in childhood blindness caused by a bi-allelic loss-of-function mutation in the CEP290 gene, with no treatment options. This therapy, named EDIT-101, delivers CRISPR/Cas9 directly into the retina of LCA patients specifically with the intronic IVS26 mutation, which drives aberrant splicing resulting in a non-functional protein. The therapy uses an AAV5 vector to deliver nucleic acid instructions for Staphylococcus aureus Cas9 and two guides targeting the ends of the CEP290 locus containing the IVS26 mutation. The DSB induced by Cas9 and both guides result in either a deletion or inversion of the IVS26 intronic region, thus preventing the aberrant splicing caused by the genetic mutation and enabling subsequent translation of the functional protein (107). Potential immunotoxicity or OTEs arising from nucleic acid viral delivery will have to be closely monitored. Nonetheless, a possibly curative medicine for genetic blindness using an in vivo approach marks an important advancement for CRISPR gene therapy.

CRISPR Editing in Human Embryos and Ethical Considerations

While somatic editing for CRISPR therapy has been permitted after careful consideration, human germline editing for therapeutic intent remains highly controversial. With somatic edition, any potential risk would be contained within the individual after informed consent to partake in the therapy. Embryonic editing not only removes autonomy in the decision-making process of the later born individuals, but also allows unforeseen and permanent side effects to pass down through generations. This very power warrants proceeding with caution to prevent major setbacks as witnessed by traditional gene therapy. However, a controversial CRISPR trial in human embryos led by Jiankui He may have already breached the ethical standards set in place for such trials. This pilot study involved genetic engineering of the C-C chemokine receptor type 5 (CCR5) gene in human embryos, with the intention of conferring HIV-resistance, as seen by a naturally occurring CCR5Δ32 mutation in a few individuals (108). However, based on the limited evidence, CRISPR/Cas9 was likely used to target this gene, but rather than replicate the naturally observed and beneficial 32-base deletion, the edits merely induced DSBs at one end of the deletion, allowing NHEJ to repair the damaged DNA while introducing random, uncharacterized mutations. Thus, it is unknown whether the resultant protein will function similarly to the naturally occurring CCR5Δ32 protein and confer HIV resistance. In addition, only one of the two embryos, termed with the pseudonym Nana, had successful edits in both copies of the CCR5 gene, whereas the other embryo, with pseudonym Lulu, had successful editing in only one copy. Despite these findings, both embryos were implanted back into their mother, knowing that the HIV-resistance will be questionable in Nana and non-existent in Lulu (109, 110).

Furthermore, recent studies have shown that the mechanism for infection of some variants of the highly mutable HIV virus may heavily rely on the C-X-C chemokine receptor type 4 (CXCR4) co-receptor (108, 111). With no attempts at editing CXCR4, this adds yet another layer of skepticism toward achieving HIV resistance by this strategy. In addition, OTEs, particularly over the lifetime of an individual, remain a major concern for applying this technology in humans. The recent advances in the editing tool to limit OTEs, such as using high fidelity Cas9 variants, has not been exploited. Furthermore, the rationale for selecting HIV prevention for the first use of CRISPR in implanted human embryos contributes to the poor risk to benefit ratio of this study, considering HIV patients can live long, healthy lives on a drug regimen. A more appropriate first attempt would have been to employ this technology for a more severe disease. For example, correction of the MYBPC3 gene is arguably a better target for embryonic gene editing, as mutations in MYBPC3 can cause hypertrophic cardiomyopathy (HCM), a heart condition responsible for most sudden cardiac deaths in people under the age of 30. Gene correction for this pathological mutation was achieved recently for the first time in the US in viable human embryos using the HDR-mediated CRISPR/Cas9 system. However, these embryos were edited for basic research purposes and not intended for implantation. In this study, sperm carrying the pathogenic MYBPC3 mutation and the CRISPR/Cas9 machinery as an RNP complex were microinjected into healthy donor oocytes arrested at MII, achieving 72.4% homozygous wildtype embryos as opposed to 47.4% in untreated embryos. The HDR-mediated gene correction was observed at considerably high frequencies with no detectable OTEs in selected blastomeres, likely owing to the direct microinjection delivery of the RNP complex in the early zygote. Interestingly, the maternal wildtype DNA was used preferentially for templated repair over the provided exogenous ssODN template (112). While evidence for gene correction was promising, NHEJ mediated DNA repair was still observed in many embryos, highlighting the need to improve HDR efficiency before clinical application can be considered. Although strategies have been developed to improve HDR, such as chemical inhibitors of NHEJ (77�), such techniques may have varying outcomes in embryonic cells and side effects that may arise from treatment needs to be investigated. Germline gene editing will remain to be ethically unfavorable at its current state and its discussions may not be considered until sufficient long-term studies of the ongoing somatic CRISPR therapy clinical trials are evaluated.


Gene Drives

Yet another fascinating application of CRISPR is a tool called a gene drive. Originally conceived by Harvard biologist Kevin Esvelt, a gene drive is a synthetic segment of DNA that includes the Cas9 gene and a guideRNA gene, along with a particular gene of interest (also called payload DNA), all in one self-functioning unit (Esvelt et al., 2014). The payload DNA can be a new gene or a modified version of an existing gene.

Once a gene drive is introduced into the chromosome of a diploid organism, the drive will generate a Cas9/guideRNA complex that will cut the homologous chromosome and then copy the gene drive into the break via HDR. With the gene drive now present in both chromosomes, the organism is homozygous for the drive, including the payload DNA (Figure 8).

Structure of a CRISPR gene drive. (A) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (B) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (C) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Structure of a CRISPR gene drive. (A) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (B) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (C) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Gene drives are capable of knocking-in or knocking-out genes in an organism. More importantly, gene drives can be propagated into an entire population of organisms via sexual reproduction, thus allowing for genetic modification at the population level.

Consider Figure 9A, which shows how a gene is propagated in a population via normal inheritance – that is, with no gene drives involved. If one of the original parents is heterozygous for a gene of interest, then the gene should statistically be transmitted to half of the offspring. This pattern of inheritance would continue in subsequent generations with the gene never accumulating to an appreciable level within the population.

WTvhUkCteg0tUw9cs3JGHWqWdw9F8zV-qwoTKX5WVSQAzgISOD6ZhB-t1DdB9QS0rryNrBEw0yZIVVaaQ0mMj9o0RIOdStWb1hQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA" alt="Normal vs. gene-drive-based inheritance. (A) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

Normal vs. gene-drive-based inheritance. (A) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

50% of the offspring but will never accumulate in the population at large. (B) One of the original parents is heterozygous for the gene of interest, which is located within a gene drive. The gene drive copies the drive and gene of interest into the other homologous chromosome, thus making the parent homozygous. As such, the gene drive is passed to 100% of the offspring. The offspring are initially heterozygous for the gene and drive but, like the parent, become homozygous. Thus, the gene of interest is rapidly propagated into the population.

Now look at how the gene could be propagated using a gene drive (Figure 9B). The original parent would initially be heterozygous for the gene drive (including the gene of interest), but the drive itself would ensure that it is copied into the homologous chromosome, thus making the parent homozygous for the drive and payload gene. Zygotes in the first generation of offspring would initially be heterozygous for the gene drive, but once again, the drive would copy itself into the homologous chromosome, ensuring that the offspring become homozygous. This pattern of inheritance would continue in subsequent generations with the drive and gene of interest becoming increasingly present within the population. So, how might this technology be used?

In one interesting application, scientists are hoping to use gene drives to eliminate malaria, a disease that continues to kill over a million people every year. The malarial parasite is transmitted by the Anopholes mosquito. Researchers created a gene drive that makes females of the species reproductively sterile (Hammond et al., 2015). Introducing the gene drive into the environment could conceivably drive the mosquito species to extinction and help eradicate the disease. In February 2019, researchers in Italy began a large-scale release of the CRISPR-edited mosquitos into a controlled high-security environment. If the technology works, gene drives could be used to address other insect-borne diseases, such as Zika virus. Moreover, gene drives could help eradicate invasive pests and create more efficient crops.

Gene drives represent an extremely powerful technology with the potential to alter entire populations of organisms. Indeed, the enormous power of gene drives has not gone unnoticed by the U.S. government. In 2016, the director of national intelligence added gene editing to a list of threats posed by “Weapons of Mass Destruction and Proliferation.” Ironically, Esvelt's lab is already working on an antidote to gene drives: a gene drive programmed to remove another gene drive.


HnRNP A2B1 (HNRNPA2B1) Human Gene Knockout Kit (CRISPR)

HNRNPA2B1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

Product images

Specifications

KN419318G1, HNRNPA2B1 gRNA vector 1 in pCas-Guide CRISPR vector

KN419318G2, HNRNPA2B1 gRNA vector 2 in pCas-Guide CRISPR vector

KN419318D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


Celf3 Mouse Gene Knockout Kit (CRISPR)

Celf3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.

Product images

Specifications

KN503115G1, Celf3 gRNA vector 1 in pCas-Guide CRISPR vector

KN503115G2, Celf3 gRNA vector 2 in pCas-Guide CRISPR vector

KN503115D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


Watch the video: NOTFALL!!!!!! DER BITCOIN PREIS WIRD EINE BEWEGUNG MACHEN MIT DER KEINER RECHNET!!!!!!!!!!!! (October 2022).